\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223678969:

Variant ID: vg1223678969 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23678969
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


AGGAGGTCAGGAGCTATAGAAGCTATCGAGCGACCATCGATCCACCGATCAGTCCAGAAGAGCGTGGACTGACCATCTCCCAGGATAGAGAAGGTGGATG[T/C]
TGTGAACATATCGGAGACGCTCCGCTCAACAGGGGCCTTCAGATCAGACCAGTAGGGGTGTCCTGAGCGCTGAAGCCAGAGCCAGCGAACTCTCAAGGCA

Reverse complement sequence

TGCCTTGAGAGTTCGCTGGCTCTGGCTTCAGCGCTCAGGACACCCCTACTGGTCTGATCTGAAGGCCCCTGTTGAGCGGAGCGTCTCCGATATGTTCACA[A/G]
CATCCACCTTCTCTATCCTGGGAGATGGTCAGTCCACGCTCTTCTGGACTGATCGGTGGATCGATGGTCGCTCGATAGCTTCTATAGCTCCTGACCTCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.60% 0.10% 32.16% 30.11% NA
All Indica  2759 4.50% 0.20% 45.34% 49.98% NA
All Japonica  1512 99.10% 0.00% 0.40% 0.53% NA
Aus  269 5.20% 0.00% 88.48% 6.32% NA
Indica I  595 2.20% 0.20% 32.27% 65.38% NA
Indica II  465 6.50% 0.00% 49.68% 43.87% NA
Indica III  913 3.30% 0.40% 57.50% 38.77% NA
Indica Intermediate  786 6.50% 0.00% 38.55% 54.96% NA
Temperate Japonica  767 99.30% 0.00% 0.39% 0.26% NA
Tropical Japonica  504 98.40% 0.00% 0.40% 1.19% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 89.60% 0.00% 8.33% 2.08% NA
Intermediate  90 62.20% 0.00% 18.89% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223678969 T -> C LOC_Os12g38560.1 downstream_gene_variant ; 1574.0bp to feature; MODIFIER silent_mutation Average:17.854; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N
vg1223678969 T -> C LOC_Os12g38560-LOC_Os12g38570 intergenic_region ; MODIFIER silent_mutation Average:17.854; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N
vg1223678969 T -> DEL N N silent_mutation Average:17.854; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223678969 NA 7.51E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1223678969 NA 1.85E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223678969 NA 2.87E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223678969 NA 3.11E-07 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223678969 NA 3.07E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223678969 NA 1.25E-31 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223678969 5.64E-07 NA mr1022_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223678969 1.65E-08 NA mr1055_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223678969 2.68E-08 NA mr1079_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223678969 2.40E-07 2.27E-10 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223678969 9.93E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223678969 2.94E-09 NA mr1390_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223678969 1.51E-07 NA mr1490_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251