\
| Variant ID: vg1223678969 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23678969 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 80. )
AGGAGGTCAGGAGCTATAGAAGCTATCGAGCGACCATCGATCCACCGATCAGTCCAGAAGAGCGTGGACTGACCATCTCCCAGGATAGAGAAGGTGGATG[T/C]
TGTGAACATATCGGAGACGCTCCGCTCAACAGGGGCCTTCAGATCAGACCAGTAGGGGTGTCCTGAGCGCTGAAGCCAGAGCCAGCGAACTCTCAAGGCA
TGCCTTGAGAGTTCGCTGGCTCTGGCTTCAGCGCTCAGGACACCCCTACTGGTCTGATCTGAAGGCCCCTGTTGAGCGGAGCGTCTCCGATATGTTCACA[A/G]
CATCCACCTTCTCTATCCTGGGAGATGGTCAGTCCACGCTCTTCTGGACTGATCGGTGGATCGATGGTCGCTCGATAGCTTCTATAGCTCCTGACCTCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.60% | 0.10% | 32.16% | 30.11% | NA |
| All Indica | 2759 | 4.50% | 0.20% | 45.34% | 49.98% | NA |
| All Japonica | 1512 | 99.10% | 0.00% | 0.40% | 0.53% | NA |
| Aus | 269 | 5.20% | 0.00% | 88.48% | 6.32% | NA |
| Indica I | 595 | 2.20% | 0.20% | 32.27% | 65.38% | NA |
| Indica II | 465 | 6.50% | 0.00% | 49.68% | 43.87% | NA |
| Indica III | 913 | 3.30% | 0.40% | 57.50% | 38.77% | NA |
| Indica Intermediate | 786 | 6.50% | 0.00% | 38.55% | 54.96% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.39% | 0.26% | NA |
| Tropical Japonica | 504 | 98.40% | 0.00% | 0.40% | 1.19% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 8.33% | 2.08% | NA |
| Intermediate | 90 | 62.20% | 0.00% | 18.89% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223678969 | T -> C | LOC_Os12g38560.1 | downstream_gene_variant ; 1574.0bp to feature; MODIFIER | silent_mutation | Average:17.854; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 | N | N | N | N |
| vg1223678969 | T -> C | LOC_Os12g38560-LOC_Os12g38570 | intergenic_region ; MODIFIER | silent_mutation | Average:17.854; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 | N | N | N | N |
| vg1223678969 | T -> DEL | N | N | silent_mutation | Average:17.854; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223678969 | NA | 7.51E-19 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1223678969 | NA | 1.85E-25 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223678969 | NA | 2.87E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223678969 | NA | 3.11E-07 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223678969 | NA | 3.07E-20 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223678969 | NA | 1.25E-31 | mr1737 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223678969 | 5.64E-07 | NA | mr1022_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223678969 | 1.65E-08 | NA | mr1055_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223678969 | 2.68E-08 | NA | mr1079_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223678969 | 2.40E-07 | 2.27E-10 | mr1334_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223678969 | 9.93E-06 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223678969 | 2.94E-09 | NA | mr1390_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223678969 | 1.51E-07 | NA | mr1490_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |