\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223626565:

Variant ID: vg1223626565 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23626565
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCAAACATAGAACACGGAAACCCAGGAATTGAGTCTTTTTTTTGGACGGAGGGAGTATGTCACTATTACTAGCTTGTAGTAACCGTAGCCCGTGCAACT[A/G]
CAACAAAAGGACAGTCGAATAGGACCTATATACGATTCATACACAAAGTATTGTCTCCATTTTAAAATATAAGACACAACCACCCTTAACTCAAAGACCA

Reverse complement sequence

TGGTCTTTGAGTTAAGGGTGGTTGTGTCTTATATTTTAAAATGGAGACAATACTTTGTGTATGAATCGTATATAGGTCCTATTCGACTGTCCTTTTGTTG[T/C]
AGTTGCACGGGCTACGGTTACTACAAGCTAGTAATAGTGACATACTCCCTCCGTCCAAAAAAAAGACTCAATTCCTGGGTTTCCGTGTTCTATGTTTGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.30% 14.50% 0.15% 0.00% NA
All Indica  2759 99.10% 0.80% 0.04% 0.00% NA
All Japonica  1512 62.00% 37.70% 0.33% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 43.40% 55.90% 0.65% 0.00% NA
Tropical Japonica  504 84.30% 15.70% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 25.70% 0.00% 0.00% NA
VI/Aromatic  96 16.70% 82.30% 1.04% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223626565 A -> G LOC_Os12g38480.2 downstream_gene_variant ; 2481.0bp to feature; MODIFIER silent_mutation Average:62.982; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg1223626565 A -> G LOC_Os12g38480-LOC_Os12g38490 intergenic_region ; MODIFIER silent_mutation Average:62.982; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1223626565 A G -0.04 -0.03 0.0 0.03 0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223626565 NA 1.28E-16 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1223626565 3.11E-07 NA mr1037_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223626565 NA 2.08E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223626565 NA 1.23E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251