Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223544640:

Variant ID: vg1223544640 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23544640
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.26, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

TACCTCTTCCCCTGTTCATCGCTTGCCTCTTGTCTCTTATGCATGACCGAGACACCACGCATAGGCAAGGTCCAATTTGTAAAATTTAAGTTTTTATCTT[A/G]
CATGTGTATGGTGGTTATTGAAGTTGAAATTGATTAGTTTTTAAGGAGTATATGGTCCTTGCAATTTTTGGTCATGCTCACATCTTCACCTAGCAATAAG

Reverse complement sequence

CTTATTGCTAGGTGAAGATGTGAGCATGACCAAAAATTGCAAGGACCATATACTCCTTAAAAACTAATCAATTTCAACTTCAATAACCACCATACACATG[T/C]
AAGATAAAAACTTAAATTTTACAAATTGGACCTTGCCTATGCGTGGTGTCTCGGTCATGCATAAGAGACAAGAGGCAAGCGATGAACAGGGGAAGAGGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.90%	18.90%	0.32%	56.92%	NA
All Indica	2759	10.40%	2.00%	0.36%	87.21%	NA
All Japonica	1512	47.60%	51.60%	0.26%	0.60%	NA
Aus	269	7.40%	5.90%	0.00%	86.62%	NA
Indica I	595	4.00%	1.30%	1.01%	93.61%	NA
Indica II	465	24.30%	3.20%	0.00%	72.47%	NA
Indica III	913	6.20%	1.40%	0.00%	92.33%	NA
Indica Intermediate	786	11.80%	2.50%	0.51%	85.11%	NA
Temperate Japonica	767	57.40%	42.00%	0.39%	0.26%	NA
Tropical Japonica	504	26.60%	72.00%	0.20%	1.19%	NA
Japonica Intermediate	241	60.20%	39.40%	0.00%	0.41%	NA
VI/Aromatic	96	85.40%	4.20%	0.00%	10.42%	NA
Intermediate	90	23.30%	40.00%	1.11%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223544640	A -> DEL	N	N	silent_mutation	Average:12.633; most accessible tissue: Callus, score: 68.888	N	N	N	N
vg1223544640	A -> G	LOC_Os12g38380.1	upstream_gene_variant ; 723.0bp to feature; MODIFIER	silent_mutation	Average:12.633; most accessible tissue: Callus, score: 68.888	N	N	N	N
vg1223544640	A -> G	LOC_Os12g38370.1	downstream_gene_variant ; 4704.0bp to feature; MODIFIER	silent_mutation	Average:12.633; most accessible tissue: Callus, score: 68.888	N	N	N	N
vg1223544640	A -> G	LOC_Os12g38370-LOC_Os12g38380	intergenic_region ; MODIFIER	silent_mutation	Average:12.633; most accessible tissue: Callus, score: 68.888	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223544640	NA	6.23E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223544640	4.11E-06	4.11E-06	mr1525	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223544640	NA	3.37E-06	mr1553	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223544640	NA	3.90E-06	mr1817	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251