\
| Variant ID: vg1223534586 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23534586 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 89. )
TATATCAGTTGTTCTAGGGTGGTTTTAGTGGTTTAATTTGTGGATAAGGAAGGTTAGAGAAGGAGTTTTGTTTGTTGTGGTTCGAATTGGCTGTTCTGCA[T/C]
GTTGGCAGATTTACAGTGTTTCGGTTTTTTGAAGTTTCGGAGAGCTAAATGATATTTTCTGCGAAAGTGTATAACTAGAAAGTTGTAGATAATATTTATA
TATAAATATTATCTACAACTTTCTAGTTATACACTTTCGCAGAAAATATCATTTAGCTCTCCGAAACTTCAAAAAACCGAAACACTGTAAATCTGCCAAC[A/G]
TGCAGAACAGCCAATTCGAACCACAACAAACAAAACTCCTTCTCTAACCTTCCTTATCCACAAATTAAACCACTAAAACCACCCTAGAACAACTGATATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.30% | 19.70% | 4.04% | 1.04% | NA |
| All Indica | 2759 | 95.10% | 3.20% | 1.78% | 0.00% | NA |
| All Japonica | 1512 | 46.30% | 49.00% | 1.46% | 3.24% | NA |
| Aus | 269 | 35.30% | 25.30% | 39.41% | 0.00% | NA |
| Indica I | 595 | 97.60% | 1.00% | 1.34% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 95.40% | 3.50% | 1.10% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 4.50% | 3.69% | 0.00% | NA |
| Temperate Japonica | 767 | 56.20% | 38.70% | 1.96% | 3.13% | NA |
| Tropical Japonica | 504 | 25.20% | 69.60% | 0.99% | 4.17% | NA |
| Japonica Intermediate | 241 | 58.90% | 38.60% | 0.83% | 1.66% | NA |
| VI/Aromatic | 96 | 93.80% | 3.10% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 33.30% | 12.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223534586 | T -> C | LOC_Os12g38370.1 | upstream_gene_variant ; 4610.0bp to feature; MODIFIER | silent_mutation | Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1223534586 | T -> C | LOC_Os12g38350.1 | downstream_gene_variant ; 3573.0bp to feature; MODIFIER | silent_mutation | Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1223534586 | T -> C | LOC_Os12g38360.1 | downstream_gene_variant ; 1391.0bp to feature; MODIFIER | silent_mutation | Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1223534586 | T -> C | LOC_Os12g38360-LOC_Os12g38370 | intergenic_region ; MODIFIER | silent_mutation | Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1223534586 | T -> DEL | N | N | silent_mutation | Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223534586 | NA | 4.69E-13 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223534586 | NA | 1.07E-12 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223534586 | NA | 2.91E-08 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223534586 | NA | 1.30E-11 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223534586 | NA | 1.12E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223534586 | NA | 1.34E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223534586 | 6.10E-06 | 2.56E-20 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223534586 | NA | 3.09E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223534586 | NA | 1.03E-09 | mr1335_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |