\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223534586:

Variant ID: vg1223534586 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23534586
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TATATCAGTTGTTCTAGGGTGGTTTTAGTGGTTTAATTTGTGGATAAGGAAGGTTAGAGAAGGAGTTTTGTTTGTTGTGGTTCGAATTGGCTGTTCTGCA[T/C]
GTTGGCAGATTTACAGTGTTTCGGTTTTTTGAAGTTTCGGAGAGCTAAATGATATTTTCTGCGAAAGTGTATAACTAGAAAGTTGTAGATAATATTTATA

Reverse complement sequence

TATAAATATTATCTACAACTTTCTAGTTATACACTTTCGCAGAAAATATCATTTAGCTCTCCGAAACTTCAAAAAACCGAAACACTGTAAATCTGCCAAC[A/G]
TGCAGAACAGCCAATTCGAACCACAACAAACAAAACTCCTTCTCTAACCTTCCTTATCCACAAATTAAACCACTAAAACCACCCTAGAACAACTGATATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.30% 19.70% 4.04% 1.04% NA
All Indica  2759 95.10% 3.20% 1.78% 0.00% NA
All Japonica  1512 46.30% 49.00% 1.46% 3.24% NA
Aus  269 35.30% 25.30% 39.41% 0.00% NA
Indica I  595 97.60% 1.00% 1.34% 0.00% NA
Indica II  465 96.60% 3.00% 0.43% 0.00% NA
Indica III  913 95.40% 3.50% 1.10% 0.00% NA
Indica Intermediate  786 91.90% 4.50% 3.69% 0.00% NA
Temperate Japonica  767 56.20% 38.70% 1.96% 3.13% NA
Tropical Japonica  504 25.20% 69.60% 0.99% 4.17% NA
Japonica Intermediate  241 58.90% 38.60% 0.83% 1.66% NA
VI/Aromatic  96 93.80% 3.10% 3.12% 0.00% NA
Intermediate  90 54.40% 33.30% 12.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223534586 T -> C LOC_Os12g38370.1 upstream_gene_variant ; 4610.0bp to feature; MODIFIER silent_mutation Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1223534586 T -> C LOC_Os12g38350.1 downstream_gene_variant ; 3573.0bp to feature; MODIFIER silent_mutation Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1223534586 T -> C LOC_Os12g38360.1 downstream_gene_variant ; 1391.0bp to feature; MODIFIER silent_mutation Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1223534586 T -> C LOC_Os12g38360-LOC_Os12g38370 intergenic_region ; MODIFIER silent_mutation Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1223534586 T -> DEL N N silent_mutation Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223534586 NA 4.69E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586 NA 1.07E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586 NA 2.91E-08 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586 NA 1.30E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586 NA 1.12E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586 NA 1.34E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586 6.10E-06 2.56E-20 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586 NA 3.09E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586 NA 1.03E-09 mr1335_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251