\
| Variant ID: vg1223507277 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23507277 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 130. )
CGACCTTGCTTTTATCTTGGGAGAGGTGGACTGGGTGTTGACTACCCCATGTCCTATAGAACCTGCTGAACTTATCAGAGGTGAAAATGAGTCAGATGCT[G/A]
ACTGGCAAAAGAGACAGAGGGACAATGCTCCTCTCGTCATGTCGTATGACATTGAACAAAAGAAATGGTCCTTAGCCAACAAGAAATGTTTGGCTGTGGT
ACCACAGCCAAACATTTCTTGTTGGCTAAGGACCATTTCTTTTGTTCAATGTCATACGACATGACGAGAGGAGCATTGTCCCTCTGTCTCTTTTGCCAGT[C/T]
AGCATCTGACTCATTTTCACCTCTGATAAGTTCAGCAGGTTCTATAGGACATGGGGTAGTCAACACCCAGTCCACCTCTCCCAAGATAAAAGCAAGGTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.90% | 4.10% | 0.44% | 1.52% | NA |
| All Indica | 2759 | 89.70% | 7.00% | 0.76% | 2.61% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.40% | 10.90% | 0.67% | 0.00% | NA |
| Indica II | 465 | 86.90% | 0.60% | 0.86% | 11.61% | NA |
| Indica III | 913 | 91.70% | 7.70% | 0.44% | 0.22% | NA |
| Indica Intermediate | 786 | 89.90% | 6.90% | 1.15% | 2.04% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223507277 | G -> DEL | LOC_Os12g38280.1 | N | frameshift_variant | Average:37.119; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg1223507277 | G -> A | LOC_Os12g38280.1 | missense_variant ; p.Asp113Asn; MODERATE | nonsynonymous_codon ; D113N | Average:37.119; most accessible tissue: Minghui63 young leaf, score: 53.016 | unknown | unknown | TOLERATED | 0.18 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223507277 | 1.15E-06 | 2.59E-09 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223507277 | 1.33E-06 | 5.86E-09 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223507277 | 3.67E-06 | NA | mr1141 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223507277 | 2.79E-06 | NA | mr1141 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223507277 | 3.27E-07 | 1.25E-09 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223507277 | 1.10E-06 | 1.90E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223507277 | 3.34E-07 | 1.20E-09 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223507277 | 7.36E-07 | 1.47E-08 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223507277 | 2.62E-10 | 1.30E-12 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223507277 | 1.77E-09 | 1.37E-11 | mr1389_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |