Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223454479:

Variant ID: vg1223454479 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23454479
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.31, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

GTAAGATCTGGTCGTGTAAGAGTTCTCGCCGTGCGTATTAACCAAGCCGTGTAATCGGAAATGGACTTTCCAACTTCACGGCTGGGGGCTAGGATCAGTG[T/C]
TTGTTCAACCGAGGCAGGTTGAAGGTCCAAGAGCCTTATCCTCCGAGAATGATTCTCCGACGACAAGGCTGGGGGCTAGGGAGAGTGTATGACTCTACAA

Reverse complement sequence

TTGTAGAGTCATACACTCTCCCTAGCCCCCAGCCTTGTCGTCGGAGAATCATTCTCGGAGGATAAGGCTCTTGGACCTTCAACCTGCCTCGGTTGAACAA[A/G]
CACTGATCCTAGCCCCCAGCCGTGAAGTTGGAAAGTCCATTTCCGATTACACGGCTTGGTTAATACGCACGGCGAGAACTCTTACACGACCAGATCTTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.90%	38.40%	0.59%	5.14%	NA
All Indica	2759	86.90%	3.60%	1.01%	8.55%	NA
All Japonica	1512	0.60%	99.00%	0.00%	0.40%	NA
Aus	269	69.10%	30.90%	0.00%	0.00%	NA
Indica I	595	96.50%	3.00%	0.50%	0.00%	NA
Indica II	465	58.10%	6.00%	2.37%	33.55%	NA
Indica III	913	97.00%	1.60%	0.22%	1.10%	NA
Indica Intermediate	786	84.90%	4.70%	1.53%	8.91%	NA
Temperate Japonica	767	0.30%	99.00%	0.00%	0.78%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	87.50%	0.00%	1.04%	NA
Intermediate	90	41.10%	58.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223454479	T -> C	LOC_Os12g38200.1	upstream_gene_variant ; 3858.0bp to feature; MODIFIER	silent_mutation	Average:38.914; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg1223454479	T -> C	LOC_Os12g38190.1	downstream_gene_variant ; 367.0bp to feature; MODIFIER	silent_mutation	Average:38.914; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg1223454479	T -> C	LOC_Os12g38190-LOC_Os12g38200	intergenic_region ; MODIFIER	silent_mutation	Average:38.914; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg1223454479	T -> DEL	N	N	silent_mutation	Average:38.914; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223454479	NA	3.87E-26	mr1130	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479	NA	3.84E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479	NA	9.43E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479	NA	2.76E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479	5.70E-06	1.82E-07	mr1582	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479	NA	4.75E-06	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479	NA	6.28E-06	mr1772	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479	7.79E-07	1.01E-07	mr1772	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479	NA	6.37E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251