\
| Variant ID: vg1223454479 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23454479 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.31, others allele: 0.00, population size: 69. )
GTAAGATCTGGTCGTGTAAGAGTTCTCGCCGTGCGTATTAACCAAGCCGTGTAATCGGAAATGGACTTTCCAACTTCACGGCTGGGGGCTAGGATCAGTG[T/C]
TTGTTCAACCGAGGCAGGTTGAAGGTCCAAGAGCCTTATCCTCCGAGAATGATTCTCCGACGACAAGGCTGGGGGCTAGGGAGAGTGTATGACTCTACAA
TTGTAGAGTCATACACTCTCCCTAGCCCCCAGCCTTGTCGTCGGAGAATCATTCTCGGAGGATAAGGCTCTTGGACCTTCAACCTGCCTCGGTTGAACAA[A/G]
CACTGATCCTAGCCCCCAGCCGTGAAGTTGGAAAGTCCATTTCCGATTACACGGCTTGGTTAATACGCACGGCGAGAACTCTTACACGACCAGATCTTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.90% | 38.40% | 0.59% | 5.14% | NA |
| All Indica | 2759 | 86.90% | 3.60% | 1.01% | 8.55% | NA |
| All Japonica | 1512 | 0.60% | 99.00% | 0.00% | 0.40% | NA |
| Aus | 269 | 69.10% | 30.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.50% | 3.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 58.10% | 6.00% | 2.37% | 33.55% | NA |
| Indica III | 913 | 97.00% | 1.60% | 0.22% | 1.10% | NA |
| Indica Intermediate | 786 | 84.90% | 4.70% | 1.53% | 8.91% | NA |
| Temperate Japonica | 767 | 0.30% | 99.00% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 87.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 41.10% | 58.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223454479 | T -> C | LOC_Os12g38200.1 | upstream_gene_variant ; 3858.0bp to feature; MODIFIER | silent_mutation | Average:38.914; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg1223454479 | T -> C | LOC_Os12g38190.1 | downstream_gene_variant ; 367.0bp to feature; MODIFIER | silent_mutation | Average:38.914; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg1223454479 | T -> C | LOC_Os12g38190-LOC_Os12g38200 | intergenic_region ; MODIFIER | silent_mutation | Average:38.914; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg1223454479 | T -> DEL | N | N | silent_mutation | Average:38.914; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223454479 | NA | 3.87E-26 | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454479 | NA | 3.84E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454479 | NA | 9.43E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454479 | NA | 2.76E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454479 | 5.70E-06 | 1.82E-07 | mr1582 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454479 | NA | 4.75E-06 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454479 | NA | 6.28E-06 | mr1772 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454479 | 7.79E-07 | 1.01E-07 | mr1772 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454479 | NA | 6.37E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |