Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223454479:

Variant ID: vg1223454479 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23454479
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.31, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAGATCTGGTCGTGTAAGAGTTCTCGCCGTGCGTATTAACCAAGCCGTGTAATCGGAAATGGACTTTCCAACTTCACGGCTGGGGGCTAGGATCAGTG[T/C]
TTGTTCAACCGAGGCAGGTTGAAGGTCCAAGAGCCTTATCCTCCGAGAATGATTCTCCGACGACAAGGCTGGGGGCTAGGGAGAGTGTATGACTCTACAA

Reverse complement sequence

TTGTAGAGTCATACACTCTCCCTAGCCCCCAGCCTTGTCGTCGGAGAATCATTCTCGGAGGATAAGGCTCTTGGACCTTCAACCTGCCTCGGTTGAACAA[A/G]
CACTGATCCTAGCCCCCAGCCGTGAAGTTGGAAAGTCCATTTCCGATTACACGGCTTGGTTAATACGCACGGCGAGAACTCTTACACGACCAGATCTTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 38.40% 0.59% 5.14% NA
All Indica  2759 86.90% 3.60% 1.01% 8.55% NA
All Japonica  1512 0.60% 99.00% 0.00% 0.40% NA
Aus  269 69.10% 30.90% 0.00% 0.00% NA
Indica I  595 96.50% 3.00% 0.50% 0.00% NA
Indica II  465 58.10% 6.00% 2.37% 33.55% NA
Indica III  913 97.00% 1.60% 0.22% 1.10% NA
Indica Intermediate  786 84.90% 4.70% 1.53% 8.91% NA
Temperate Japonica  767 0.30% 99.00% 0.00% 0.78% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 87.50% 0.00% 1.04% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223454479 T -> C LOC_Os12g38200.1 upstream_gene_variant ; 3858.0bp to feature; MODIFIER silent_mutation Average:38.914; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1223454479 T -> C LOC_Os12g38190.1 downstream_gene_variant ; 367.0bp to feature; MODIFIER silent_mutation Average:38.914; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1223454479 T -> C LOC_Os12g38190-LOC_Os12g38200 intergenic_region ; MODIFIER silent_mutation Average:38.914; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1223454479 T -> DEL N N silent_mutation Average:38.914; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223454479 NA 3.87E-26 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479 NA 3.84E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479 NA 9.43E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479 NA 2.76E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479 5.70E-06 1.82E-07 mr1582 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479 NA 4.75E-06 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479 NA 6.28E-06 mr1772 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479 7.79E-07 1.01E-07 mr1772 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454479 NA 6.37E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251