\
| Variant ID: vg1223454241 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23454241 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 68. )
ACCAGAGGTGTAGCGATTCTCCCACTACCTCTACCTCAACAAAGTTGATATCAGGTACACAATATCGCCAAGTGTTTTACCCAGAGATCCCTTACCACGA[T/C]
GACACCTAGAGTTGAAACATATCCTCATGTCCCTTTACGCCGTCTTGACAAGGCCTCTGAGGAACCTAAGGGAACTTCGGCTGGGGACGCCCAGAGCAGA
TCTGCTCTGGGCGTCCCCAGCCGAAGTTCCCTTAGGTTCCTCAGAGGCCTTGTCAAGACGGCGTAAAGGGACATGAGGATATGTTTCAACTCTAGGTGTC[A/G]
TCGTGGTAAGGGATCTCTGGGTAAAACACTTGGCGATATTGTGTACCTGATATCAACTTTGTTGAGGTAGAGGTAGTGGGAGAATCGCTACACCTCTGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.50% | 38.20% | 0.55% | 5.80% | NA |
| All Indica | 2759 | 86.40% | 3.30% | 0.65% | 9.57% | NA |
| All Japonica | 1512 | 0.60% | 99.00% | 0.00% | 0.40% | NA |
| Aus | 269 | 69.10% | 28.30% | 2.23% | 0.37% | NA |
| Indica I | 595 | 96.60% | 2.70% | 0.00% | 0.67% | NA |
| Indica II | 465 | 57.40% | 5.20% | 1.72% | 35.70% | NA |
| Indica III | 913 | 97.00% | 1.60% | 0.22% | 1.10% | NA |
| Indica Intermediate | 786 | 83.60% | 4.70% | 1.02% | 10.69% | NA |
| Temperate Japonica | 767 | 0.30% | 99.00% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 87.50% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 36.70% | 60.00% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223454241 | T -> C | LOC_Os12g38200.1 | upstream_gene_variant ; 4096.0bp to feature; MODIFIER | silent_mutation | Average:41.091; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg1223454241 | T -> C | LOC_Os12g38190.1 | downstream_gene_variant ; 129.0bp to feature; MODIFIER | silent_mutation | Average:41.091; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg1223454241 | T -> C | LOC_Os12g38190-LOC_Os12g38200 | intergenic_region ; MODIFIER | silent_mutation | Average:41.091; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg1223454241 | T -> DEL | N | N | silent_mutation | Average:41.091; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223454241 | NA | 6.69E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454241 | NA | 2.83E-27 | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454241 | NA | 1.06E-07 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454241 | NA | 4.43E-14 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454241 | NA | 7.96E-06 | mr1173 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454241 | NA | 4.86E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454241 | NA | 2.21E-21 | mr1254 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454241 | 6.44E-06 | 6.44E-06 | mr1462 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454241 | 2.94E-06 | 1.45E-07 | mr1582 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454241 | NA | 8.84E-06 | mr1672 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454241 | NA | 8.45E-06 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454241 | 2.80E-07 | 4.33E-08 | mr1772 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223454241 | NA | 4.45E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |