\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223454241:

Variant ID: vg1223454241 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23454241
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAGAGGTGTAGCGATTCTCCCACTACCTCTACCTCAACAAAGTTGATATCAGGTACACAATATCGCCAAGTGTTTTACCCAGAGATCCCTTACCACGA[T/C]
GACACCTAGAGTTGAAACATATCCTCATGTCCCTTTACGCCGTCTTGACAAGGCCTCTGAGGAACCTAAGGGAACTTCGGCTGGGGACGCCCAGAGCAGA

Reverse complement sequence

TCTGCTCTGGGCGTCCCCAGCCGAAGTTCCCTTAGGTTCCTCAGAGGCCTTGTCAAGACGGCGTAAAGGGACATGAGGATATGTTTCAACTCTAGGTGTC[A/G]
TCGTGGTAAGGGATCTCTGGGTAAAACACTTGGCGATATTGTGTACCTGATATCAACTTTGTTGAGGTAGAGGTAGTGGGAGAATCGCTACACCTCTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 38.20% 0.55% 5.80% NA
All Indica  2759 86.40% 3.30% 0.65% 9.57% NA
All Japonica  1512 0.60% 99.00% 0.00% 0.40% NA
Aus  269 69.10% 28.30% 2.23% 0.37% NA
Indica I  595 96.60% 2.70% 0.00% 0.67% NA
Indica II  465 57.40% 5.20% 1.72% 35.70% NA
Indica III  913 97.00% 1.60% 0.22% 1.10% NA
Indica Intermediate  786 83.60% 4.70% 1.02% 10.69% NA
Temperate Japonica  767 0.30% 99.00% 0.00% 0.78% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 87.50% 1.04% 1.04% NA
Intermediate  90 36.70% 60.00% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223454241 T -> C LOC_Os12g38200.1 upstream_gene_variant ; 4096.0bp to feature; MODIFIER silent_mutation Average:41.091; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N
vg1223454241 T -> C LOC_Os12g38190.1 downstream_gene_variant ; 129.0bp to feature; MODIFIER silent_mutation Average:41.091; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N
vg1223454241 T -> C LOC_Os12g38190-LOC_Os12g38200 intergenic_region ; MODIFIER silent_mutation Average:41.091; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N
vg1223454241 T -> DEL N N silent_mutation Average:41.091; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223454241 NA 6.69E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454241 NA 2.83E-27 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454241 NA 1.06E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454241 NA 4.43E-14 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454241 NA 7.96E-06 mr1173 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454241 NA 4.86E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454241 NA 2.21E-21 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454241 6.44E-06 6.44E-06 mr1462 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454241 2.94E-06 1.45E-07 mr1582 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454241 NA 8.84E-06 mr1672 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454241 NA 8.45E-06 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454241 2.80E-07 4.33E-08 mr1772 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223454241 NA 4.45E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251