Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223431837:

Variant ID: vg1223431837 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23431837
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATATTCCGGCCTTTGCTAAAAAAAACTACAGCCAATTATTACAAAGATCCACTCCAAAAGAGAGTGTAGTTCAAGACAAGTTGAACACACCAAACAAGA[G/A]
AAGAGATGACCCAAACTGAGAAAAACAAAATAAAATGTGGAGCTAGAAGGCCTCGTCCAGGCCTAGGACTGAAGTTCGAAGCCAATGTATAGACCAATGA

Reverse complement sequence

TCATTGGTCTATACATTGGCTTCGAACTTCAGTCCTAGGCCTGGACGAGGCCTTCTAGCTCCACATTTTATTTTGTTTTTCTCAGTTTGGGTCATCTCTT[C/T]
TCTTGTTTGGTGTGTTCAACTTGTCTTGAACTACACTCTCTTTTGGAGTGGATCTTTGTAATAATTGGCTGTAGTTTTTTTTAGCAAAGGCCGGAATATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.50%	5.20%	0.68%	5.61%	NA
All Indica	2759	90.00%	0.40%	0.25%	9.35%	NA
All Japonica	1512	87.40%	10.90%	1.32%	0.40%	NA
Aus	269	74.70%	23.80%	1.49%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	63.20%	0.00%	0.43%	36.34%	NA
Indica III	913	98.80%	0.10%	0.00%	1.10%	NA
Indica Intermediate	786	88.20%	1.10%	0.64%	10.05%	NA
Temperate Japonica	767	97.30%	0.90%	1.04%	0.78%	NA
Tropical Japonica	504	85.70%	13.50%	0.79%	0.00%	NA
Japonica Intermediate	241	59.30%	37.30%	3.32%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	93.30%	5.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223431837	G -> DEL	N	N	silent_mutation	Average:40.438; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg1223431837	G -> A	LOC_Os12g38160.1	upstream_gene_variant ; 511.0bp to feature; MODIFIER	silent_mutation	Average:40.438; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg1223431837	G -> A	LOC_Os12g38170.1	upstream_gene_variant ; 3621.0bp to feature; MODIFIER	silent_mutation	Average:40.438; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg1223431837	G -> A	LOC_Os12g38150.1	downstream_gene_variant ; 2956.0bp to feature; MODIFIER	silent_mutation	Average:40.438; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg1223431837	G -> A	LOC_Os12g38160-LOC_Os12g38170	intergenic_region ; MODIFIER	silent_mutation	Average:40.438; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223431837	NA	2.00E-06	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223431837	NA	1.42E-06	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223431837	NA	2.51E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223431837	NA	3.13E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223431837	NA	5.68E-08	mr1519_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223431837	NA	5.27E-06	mr1861_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251