\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223300444:

Variant ID: vg1223300444 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23300444
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGATACTACTCCTATTCGATAGTACTCCCTCCGAAAAAAAGAAAAAAAATAACCTAGCTAAACATAGGTTGAGTTTTTTTAGACGAAAGCAGTGGGTCG[G/A]
AATTTAATGGATGTGTTAGGATTTTGAGTTAGACAGAGTAAGCTACTACTACTCAGTAAGAATTTGGAATATCAATTTCAATATATGACTACATGTTTTT

Reverse complement sequence

AAAAACATGTAGTCATATATTGAAATTGATATTCCAAATTCTTACTGAGTAGTAGTAGCTTACTCTGTCTAACTCAAAATCCTAACACATCCATTAAATT[C/T]
CGACCCACTGCTTTCGTCTAAAAAAACTCAACCTATGTTTAGCTAGGTTATTTTTTTTCTTTTTTTCGGAGGGAGTACTATCGAATAGGAGTAGTATCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.90% 2.10% 1.04% 0.00% NA
All Indica  2759 97.40% 1.20% 1.45% 0.00% NA
All Japonica  1512 95.20% 4.30% 0.53% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 98.70% 0.80% 0.50% 0.00% NA
Indica II  465 93.80% 2.40% 3.87% 0.00% NA
Indica III  913 98.90% 0.80% 0.33% 0.00% NA
Indica Intermediate  786 96.80% 1.10% 2.04% 0.00% NA
Temperate Japonica  767 93.20% 6.00% 0.78% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 7.90% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223300444 G -> A LOC_Os12g37910.2 upstream_gene_variant ; 1260.0bp to feature; MODIFIER silent_mutation Average:90.301; most accessible tissue: Callus, score: 96.949 N N N N
vg1223300444 G -> A LOC_Os12g37910.1 upstream_gene_variant ; 1260.0bp to feature; MODIFIER silent_mutation Average:90.301; most accessible tissue: Callus, score: 96.949 N N N N
vg1223300444 G -> A LOC_Os12g37920.1 downstream_gene_variant ; 2242.0bp to feature; MODIFIER silent_mutation Average:90.301; most accessible tissue: Callus, score: 96.949 N N N N
vg1223300444 G -> A LOC_Os12g37910-LOC_Os12g37920 intergenic_region ; MODIFIER silent_mutation Average:90.301; most accessible tissue: Callus, score: 96.949 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1223300444 G A -0.09 -0.04 -0.01 -0.03 -0.06 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223300444 NA 3.42E-09 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223300444 NA 5.02E-09 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223300444 NA 1.85E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223300444 NA 4.33E-10 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223300444 NA 1.26E-09 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223300444 3.39E-06 3.39E-06 mr1228_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223300444 NA 2.82E-08 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223300444 NA 1.06E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223300444 NA 2.31E-06 mr1552_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223300444 NA 1.36E-09 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223300444 NA 1.07E-08 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223300444 NA 5.87E-10 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251