Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223181515:

Variant ID: vg1223181515 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23181515
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

CGAGTCATACTTGTGCACCGGATGAGTTGAGTATTGGGGTACGTTGGAACGAGGGTCTACGTAGTACGACATCAAGCAAACAAAAGACAAGGATTATACT[G/A]
GTTCAGGCCCCTTGTCAGGTAATAGTCATAATCTAGTTTATATGAGATTGATGATGAGGAACCACAGATTATAAAGAAAGTAGACGAAACAACAGATACC

Reverse complement sequence

GGTATCTGTTGTTTCGTCTACTTTCTTTATAATCTGTGGTTCCTCATCATCAATCTCATATAAACTAGATTATGACTATTACCTGACAAGGGGCCTGAAC[C/T]
AGTATAATCCTTGTCTTTTGTTTGCTTGATGTCGTACTACGTAGACCCTCGTTCCAACGTACCCCAATACTCAACTCATCCGGTGCACAAGTATGACTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.50%	4.90%	0.61%	0.00%	NA
All Indica	2759	90.80%	8.30%	0.91%	0.00%	NA
All Japonica	1512	99.70%	0.00%	0.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	87.20%	12.80%	0.00%	0.00%	NA
Indica II	465	86.70%	9.00%	4.30%	0.00%	NA
Indica III	913	94.30%	5.70%	0.00%	0.00%	NA
Indica Intermediate	786	91.90%	7.50%	0.64%	0.00%	NA
Temperate Japonica	767	99.50%	0.00%	0.52%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223181515	G -> A	LOC_Os12g37760.1	upstream_gene_variant ; 1048.0bp to feature; MODIFIER	silent_mutation	Average:43.968; most accessible tissue: Callus, score: 71.303	N	N	N	N
vg1223181515	G -> A	LOC_Os12g37750-LOC_Os12g37760	intergenic_region ; MODIFIER	silent_mutation	Average:43.968; most accessible tissue: Callus, score: 71.303	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223181515	NA	2.30E-06	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223181515	NA	6.74E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223181515	NA	6.10E-07	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223181515	NA	1.04E-06	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223181515	NA	4.16E-07	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223181515	NA	7.20E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223181515	NA	2.25E-07	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223181515	NA	1.23E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223181515	5.00E-06	4.99E-06	mr1416_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223181515	NA	3.63E-06	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251