\
| Variant ID: vg1223181515 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23181515 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 263. )
CGAGTCATACTTGTGCACCGGATGAGTTGAGTATTGGGGTACGTTGGAACGAGGGTCTACGTAGTACGACATCAAGCAAACAAAAGACAAGGATTATACT[G/A]
GTTCAGGCCCCTTGTCAGGTAATAGTCATAATCTAGTTTATATGAGATTGATGATGAGGAACCACAGATTATAAAGAAAGTAGACGAAACAACAGATACC
GGTATCTGTTGTTTCGTCTACTTTCTTTATAATCTGTGGTTCCTCATCATCAATCTCATATAAACTAGATTATGACTATTACCTGACAAGGGGCCTGAAC[C/T]
AGTATAATCCTTGTCTTTTGTTTGCTTGATGTCGTACTACGTAGACCCTCGTTCCAACGTACCCCAATACTCAACTCATCCGGTGCACAAGTATGACTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.50% | 4.90% | 0.61% | 0.00% | NA |
| All Indica | 2759 | 90.80% | 8.30% | 0.91% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.70% | 9.00% | 4.30% | 0.00% | NA |
| Indica III | 913 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 7.50% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223181515 | G -> A | LOC_Os12g37760.1 | upstream_gene_variant ; 1048.0bp to feature; MODIFIER | silent_mutation | Average:43.968; most accessible tissue: Callus, score: 71.303 | N | N | N | N |
| vg1223181515 | G -> A | LOC_Os12g37750-LOC_Os12g37760 | intergenic_region ; MODIFIER | silent_mutation | Average:43.968; most accessible tissue: Callus, score: 71.303 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223181515 | NA | 2.30E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223181515 | NA | 6.74E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223181515 | NA | 6.10E-07 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223181515 | NA | 1.04E-06 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223181515 | NA | 4.16E-07 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223181515 | NA | 7.20E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223181515 | NA | 2.25E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223181515 | NA | 1.23E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223181515 | 5.00E-06 | 4.99E-06 | mr1416_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223181515 | NA | 3.63E-06 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |