Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1223141422:

Variant ID: vg1223141422 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23141422
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, A: 0.32, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TATATAATGTATGTGTTTGATTTAGATTGTGGAGGACATGGTGGATTACTCTTATTTTACGACAATTATTTATAGGTACAAAAAATAAATTAAATACTAA[C/A]
AAAAGTAAAAAATAGATCTTAAAAAGTATTCCAAGAAATTTCTATATAGATTTTTTTTAAAAAAAAAGTGTGTACCATTTAGCAGCTTAAGAAGCATGCT

Reverse complement sequence

AGCATGCTTCTTAAGCTGCTAAATGGTACACACTTTTTTTTTAAAAAAAATCTATATAGAAATTTCTTGGAATACTTTTTAAGATCTATTTTTTACTTTT[G/T]
TTAGTATTTAATTTATTTTTTGTACCTATAAATAATTGTCGTAAAATAAGAGTAATCCACCATGTCCTCCACAATCTAAATCAAACACATACATTATATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.90%	12.10%	5.37%	2.56%	NA
All Indica	2759	73.00%	14.00%	8.70%	4.28%	NA
All Japonica	1512	99.20%	0.30%	0.40%	0.07%	NA
Aus	269	38.30%	60.20%	1.49%	0.00%	NA
Indica I	595	67.40%	11.90%	7.56%	13.11%	NA
Indica II	465	58.70%	23.90%	16.77%	0.65%	NA
Indica III	913	83.00%	9.30%	5.04%	2.63%	NA
Indica Intermediate	786	74.00%	15.30%	9.03%	1.65%	NA
Temperate Japonica	767	98.60%	0.70%	0.78%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	82.20%	11.10%	4.44%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223141422	C -> DEL	N	N	silent_mutation	Average:42.959; most accessible tissue: Zhenshan97 flower, score: 92.89	N	N	N	N
vg1223141422	C -> A	LOC_Os12g37690.1	upstream_gene_variant ; 4070.0bp to feature; MODIFIER	silent_mutation	Average:42.959; most accessible tissue: Zhenshan97 flower, score: 92.89	N	N	N	N
vg1223141422	C -> A	LOC_Os12g37690-LOC_Os12g37710	intergenic_region ; MODIFIER	silent_mutation	Average:42.959; most accessible tissue: Zhenshan97 flower, score: 92.89	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1223141422	C	A	0.0	0.01	0.0	0.0	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223141422	NA	2.17E-08	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223141422	NA	1.97E-07	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223141422	NA	4.28E-08	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223141422	NA	2.36E-08	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223141422	NA	8.24E-08	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223141422	NA	1.22E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223141422	NA	2.16E-08	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223141422	NA	7.01E-09	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223141422	NA	9.45E-08	mr1986	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223141422	NA	1.99E-06	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223141422	NA	6.05E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223141422	NA	4.47E-06	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223141422	NA	2.01E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251