\
| Variant ID: vg1223140018 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23140018 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCCCTCTCTCTTACTTTCTCCTCCGCTCCTCATCCTTATTCTCTCTCTCTCTCTCTCTCACTCGCTCTGTAGGTAGCGGAGGTGCACGAGGAGGCCAAC[G/A]
GATTGTAGCAATGATGATGGCGAATCCAGTGGCGCGCGAGGAGGCCGATGGACAGCAACGACGATAGCGGCAAATCCAGCGGCGCGCGAGGAGGCCGGCG
CGCCGGCCTCCTCGCGCGCCGCTGGATTTGCCGCTATCGTCGTTGCTGTCCATCGGCCTCCTCGCGCGCCACTGGATTCGCCATCATCATTGCTACAATC[C/T]
GTTGGCCTCCTCGTGCACCTCCGCTACCTACAGAGCGAGTGAGAGAGAGAGAGAGAGAGAATAAGGATGAGGAGCGGAGGAGAAAGTAAGAGAGAGGGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 7.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 88.30% | 11.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.00% | 13.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223140018 | G -> A | LOC_Os12g37690.1 | upstream_gene_variant ; 2666.0bp to feature; MODIFIER | silent_mutation | Average:64.382; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1223140018 | G -> A | LOC_Os12g37690-LOC_Os12g37710 | intergenic_region ; MODIFIER | silent_mutation | Average:64.382; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223140018 | NA | 2.10E-07 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223140018 | NA | 8.06E-08 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223140018 | NA | 6.08E-09 | mr1014 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223140018 | NA | 2.70E-06 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223140018 | NA | 9.09E-09 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223140018 | NA | 1.13E-08 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223140018 | 5.74E-06 | 2.06E-09 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223140018 | NA | 1.99E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223140018 | NA | 1.20E-06 | mr1008_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223140018 | 6.03E-07 | 8.76E-10 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223140018 | 1.67E-06 | 8.21E-09 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223140018 | 4.06E-08 | 1.60E-10 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223140018 | 3.06E-07 | 6.02E-10 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |