Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223140018:

Variant ID: vg1223140018 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23140018
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCCCTCTCTCTTACTTTCTCCTCCGCTCCTCATCCTTATTCTCTCTCTCTCTCTCTCTCACTCGCTCTGTAGGTAGCGGAGGTGCACGAGGAGGCCAAC[G/A]
GATTGTAGCAATGATGATGGCGAATCCAGTGGCGCGCGAGGAGGCCGATGGACAGCAACGACGATAGCGGCAAATCCAGCGGCGCGCGAGGAGGCCGGCG

Reverse complement sequence

CGCCGGCCTCCTCGCGCGCCGCTGGATTTGCCGCTATCGTCGTTGCTGTCCATCGGCCTCCTCGCGCGCCACTGGATTCGCCATCATCATTGCTACAATC[C/T]
GTTGGCCTCCTCGTGCACCTCCGCTACCTACAGAGCGAGTGAGAGAGAGAGAGAGAGAGAATAAGGATGAGGAGCGGAGGAGAAAGTAAGAGAGAGGGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.00%	7.00%	0.00%	0.00%	NA
All Indica	2759	88.30%	11.70%	0.00%	0.00%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	88.10%	11.90%	0.00%	0.00%	NA
Indica II	465	78.90%	21.10%	0.00%	0.00%	NA
Indica III	913	94.40%	5.60%	0.00%	0.00%	NA
Indica Intermediate	786	87.00%	13.00%	0.00%	0.00%	NA
Temperate Japonica	767	98.80%	1.20%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223140018	G -> A	LOC_Os12g37690.1	upstream_gene_variant ; 2666.0bp to feature; MODIFIER	silent_mutation	Average:64.382; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1223140018	G -> A	LOC_Os12g37690-LOC_Os12g37710	intergenic_region ; MODIFIER	silent_mutation	Average:64.382; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223140018	NA	2.10E-07	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018	NA	8.06E-08	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018	NA	6.08E-09	mr1014	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018	NA	2.70E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018	NA	9.09E-09	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018	NA	1.13E-08	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018	5.74E-06	2.06E-09	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018	NA	1.99E-08	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018	NA	1.20E-06	mr1008_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018	6.03E-07	8.76E-10	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018	1.67E-06	8.21E-09	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018	4.06E-08	1.60E-10	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018	3.06E-07	6.02E-10	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251