\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223140018:

Variant ID: vg1223140018 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23140018
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCCTCTCTCTTACTTTCTCCTCCGCTCCTCATCCTTATTCTCTCTCTCTCTCTCTCTCACTCGCTCTGTAGGTAGCGGAGGTGCACGAGGAGGCCAAC[G/A]
GATTGTAGCAATGATGATGGCGAATCCAGTGGCGCGCGAGGAGGCCGATGGACAGCAACGACGATAGCGGCAAATCCAGCGGCGCGCGAGGAGGCCGGCG

Reverse complement sequence

CGCCGGCCTCCTCGCGCGCCGCTGGATTTGCCGCTATCGTCGTTGCTGTCCATCGGCCTCCTCGCGCGCCACTGGATTCGCCATCATCATTGCTACAATC[C/T]
GTTGGCCTCCTCGTGCACCTCCGCTACCTACAGAGCGAGTGAGAGAGAGAGAGAGAGAGAATAAGGATGAGGAGCGGAGGAGAAAGTAAGAGAGAGGGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 7.00% 0.00% 0.00% NA
All Indica  2759 88.30% 11.70% 0.00% 0.00% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 88.10% 11.90% 0.00% 0.00% NA
Indica II  465 78.90% 21.10% 0.00% 0.00% NA
Indica III  913 94.40% 5.60% 0.00% 0.00% NA
Indica Intermediate  786 87.00% 13.00% 0.00% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223140018 G -> A LOC_Os12g37690.1 upstream_gene_variant ; 2666.0bp to feature; MODIFIER silent_mutation Average:64.382; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1223140018 G -> A LOC_Os12g37690-LOC_Os12g37710 intergenic_region ; MODIFIER silent_mutation Average:64.382; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223140018 NA 2.10E-07 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018 NA 8.06E-08 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018 NA 6.08E-09 mr1014 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018 NA 2.70E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018 NA 9.09E-09 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018 NA 1.13E-08 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018 5.74E-06 2.06E-09 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018 NA 1.99E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018 NA 1.20E-06 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018 6.03E-07 8.76E-10 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018 1.67E-06 8.21E-09 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018 4.06E-08 1.60E-10 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223140018 3.06E-07 6.02E-10 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251