\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223039351:

Variant ID: vg1223039351 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23039351
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTCGGGTGGAACTGCCTGGGGAGACGATAAACTCTTAGCTAGAATAAGTGTGACTTGGAATATCTTTTTAAGTTGCTTCTAAAAAGACAGATAAGTGAG[G/A]
CATACGGTGAGTACCGAGTAGGACTTTACATCATCTGAAACAAGCTTCTGAGGCTGTCTAAGTAGGATTCGCCACCCTGCAAAGATCCTAAAGTTAAAAT

Reverse complement sequence

ATTTTAACTTTAGGATCTTTGCAGGGTGGCGAATCCTACTTAGACAGCCTCAGAAGCTTGTTTCAGATGATGTAAAGTCCTACTCGGTACTCACCGTATG[C/T]
CTCACTTATCTGTCTTTTTAGAAGCAACTTAAAAAGATATTCCAAGTCACACTTATTCTAGCTAAGAGTTTATCGTCTCCCCAGGCAGTTCCACCCGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.30% 3.10% 26.58% 11.00% NA
All Indica  2759 44.50% 0.20% 38.53% 16.75% NA
All Japonica  1512 86.40% 9.10% 2.98% 1.52% NA
Aus  269 44.20% 0.00% 44.61% 11.15% NA
Indica I  595 66.40% 0.00% 18.82% 14.79% NA
Indica II  465 20.40% 0.20% 56.77% 22.58% NA
Indica III  913 53.00% 0.40% 37.90% 8.65% NA
Indica Intermediate  786 32.30% 0.10% 43.38% 24.17% NA
Temperate Japonica  767 93.50% 1.40% 3.13% 1.96% NA
Tropical Japonica  504 74.40% 23.80% 1.39% 0.40% NA
Japonica Intermediate  241 88.80% 2.90% 5.81% 2.49% NA
VI/Aromatic  96 88.50% 0.00% 8.33% 3.12% NA
Intermediate  90 72.20% 3.30% 22.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223039351 G -> DEL N N silent_mutation Average:7.861; most accessible tissue: Callus, score: 21.78 N N N N
vg1223039351 G -> A LOC_Os12g37530.2 upstream_gene_variant ; 3819.0bp to feature; MODIFIER silent_mutation Average:7.861; most accessible tissue: Callus, score: 21.78 N N N N
vg1223039351 G -> A LOC_Os12g37550.1 upstream_gene_variant ; 2760.0bp to feature; MODIFIER silent_mutation Average:7.861; most accessible tissue: Callus, score: 21.78 N N N N
vg1223039351 G -> A LOC_Os12g37530.1 upstream_gene_variant ; 3819.0bp to feature; MODIFIER silent_mutation Average:7.861; most accessible tissue: Callus, score: 21.78 N N N N
vg1223039351 G -> A LOC_Os12g37530.3 upstream_gene_variant ; 3819.0bp to feature; MODIFIER silent_mutation Average:7.861; most accessible tissue: Callus, score: 21.78 N N N N
vg1223039351 G -> A LOC_Os12g37540.1 downstream_gene_variant ; 1027.0bp to feature; MODIFIER silent_mutation Average:7.861; most accessible tissue: Callus, score: 21.78 N N N N
vg1223039351 G -> A LOC_Os12g37540-LOC_Os12g37550 intergenic_region ; MODIFIER silent_mutation Average:7.861; most accessible tissue: Callus, score: 21.78 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223039351 NA 1.29E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223039351 NA 7.12E-07 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223039351 NA 9.86E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223039351 NA 1.05E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223039351 NA 6.07E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223039351 NA 5.43E-07 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223039351 NA 1.40E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223039351 3.32E-06 NA mr1751_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223039351 NA 2.85E-07 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223039351 NA 3.34E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223039351 NA 5.26E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223039351 NA 3.29E-10 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251