\
| Variant ID: vg1223039351 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23039351 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTTCGGGTGGAACTGCCTGGGGAGACGATAAACTCTTAGCTAGAATAAGTGTGACTTGGAATATCTTTTTAAGTTGCTTCTAAAAAGACAGATAAGTGAG[G/A]
CATACGGTGAGTACCGAGTAGGACTTTACATCATCTGAAACAAGCTTCTGAGGCTGTCTAAGTAGGATTCGCCACCCTGCAAAGATCCTAAAGTTAAAAT
ATTTTAACTTTAGGATCTTTGCAGGGTGGCGAATCCTACTTAGACAGCCTCAGAAGCTTGTTTCAGATGATGTAAAGTCCTACTCGGTACTCACCGTATG[C/T]
CTCACTTATCTGTCTTTTTAGAAGCAACTTAAAAAGATATTCCAAGTCACACTTATTCTAGCTAAGAGTTTATCGTCTCCCCAGGCAGTTCCACCCGAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.30% | 3.10% | 26.58% | 11.00% | NA |
| All Indica | 2759 | 44.50% | 0.20% | 38.53% | 16.75% | NA |
| All Japonica | 1512 | 86.40% | 9.10% | 2.98% | 1.52% | NA |
| Aus | 269 | 44.20% | 0.00% | 44.61% | 11.15% | NA |
| Indica I | 595 | 66.40% | 0.00% | 18.82% | 14.79% | NA |
| Indica II | 465 | 20.40% | 0.20% | 56.77% | 22.58% | NA |
| Indica III | 913 | 53.00% | 0.40% | 37.90% | 8.65% | NA |
| Indica Intermediate | 786 | 32.30% | 0.10% | 43.38% | 24.17% | NA |
| Temperate Japonica | 767 | 93.50% | 1.40% | 3.13% | 1.96% | NA |
| Tropical Japonica | 504 | 74.40% | 23.80% | 1.39% | 0.40% | NA |
| Japonica Intermediate | 241 | 88.80% | 2.90% | 5.81% | 2.49% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 8.33% | 3.12% | NA |
| Intermediate | 90 | 72.20% | 3.30% | 22.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223039351 | G -> DEL | N | N | silent_mutation | Average:7.861; most accessible tissue: Callus, score: 21.78 | N | N | N | N |
| vg1223039351 | G -> A | LOC_Os12g37530.2 | upstream_gene_variant ; 3819.0bp to feature; MODIFIER | silent_mutation | Average:7.861; most accessible tissue: Callus, score: 21.78 | N | N | N | N |
| vg1223039351 | G -> A | LOC_Os12g37550.1 | upstream_gene_variant ; 2760.0bp to feature; MODIFIER | silent_mutation | Average:7.861; most accessible tissue: Callus, score: 21.78 | N | N | N | N |
| vg1223039351 | G -> A | LOC_Os12g37530.1 | upstream_gene_variant ; 3819.0bp to feature; MODIFIER | silent_mutation | Average:7.861; most accessible tissue: Callus, score: 21.78 | N | N | N | N |
| vg1223039351 | G -> A | LOC_Os12g37530.3 | upstream_gene_variant ; 3819.0bp to feature; MODIFIER | silent_mutation | Average:7.861; most accessible tissue: Callus, score: 21.78 | N | N | N | N |
| vg1223039351 | G -> A | LOC_Os12g37540.1 | downstream_gene_variant ; 1027.0bp to feature; MODIFIER | silent_mutation | Average:7.861; most accessible tissue: Callus, score: 21.78 | N | N | N | N |
| vg1223039351 | G -> A | LOC_Os12g37540-LOC_Os12g37550 | intergenic_region ; MODIFIER | silent_mutation | Average:7.861; most accessible tissue: Callus, score: 21.78 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223039351 | NA | 1.29E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223039351 | NA | 7.12E-07 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223039351 | NA | 9.86E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223039351 | NA | 1.05E-08 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223039351 | NA | 6.07E-06 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223039351 | NA | 5.43E-07 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223039351 | NA | 1.40E-08 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223039351 | 3.32E-06 | NA | mr1751_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223039351 | NA | 2.85E-07 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223039351 | NA | 3.34E-08 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223039351 | NA | 5.26E-09 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223039351 | NA | 3.29E-10 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |