Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222921847:

Variant ID: vg1222921847 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22921847
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCGTCCAAGTGGAAACCCGTTTATTGCATATCAATTAAATAGTTTTAAAATTATTAATAACTGGTTAATTTGTAAGTATCACTTCAAAATATGTAACTT[T/C]
AAATTCAGCTTTATTTTTTTATAATTAATTATAAAAATTGAATTTAAGCTAGCACATTTATAAAGTAATATATAAATGCATATATTGTTAGGTTTTTTTT

Reverse complement sequence

AAAAAAAACCTAACAATATATGCATTTATATATTACTTTATAAATGTGCTAGCTTAAATTCAATTTTTATAATTAATTATAAAAAAATAAAGCTGAATTT[A/G]
AAGTTACATATTTTGAAGTGATACTTACAAATTAACCAGTTATTAATAATTTTAAAACTATTTAATTGATATGCAATAAACGGGTTTCCACTTGGACGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.40%	11.40%	6.20%	0.00%	NA
All Indica	2759	95.30%	0.90%	3.84%	0.00%	NA
All Japonica	1512	55.50%	33.10%	11.44%	0.00%	NA
Aus	269	98.10%	0.00%	1.86%	0.00%	NA
Indica I	595	83.70%	1.70%	14.62%	0.00%	NA
Indica II	465	97.00%	2.20%	0.86%	0.00%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	97.80%	0.40%	1.78%	0.00%	NA
Temperate Japonica	767	27.50%	56.60%	15.91%	0.00%	NA
Tropical Japonica	504	90.10%	5.20%	4.76%	0.00%	NA
Japonica Intermediate	241	72.20%	16.60%	11.20%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	14.40%	10.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222921847	T -> C	LOC_Os12g37330.1	upstream_gene_variant ; 3057.0bp to feature; MODIFIER	silent_mutation	Average:40.583; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1222921847	T -> C	LOC_Os12g37320.1	intron_variant ; MODIFIER	silent_mutation	Average:40.583; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1222921847	T -> C	LOC_Os12g37320.2	intron_variant ; MODIFIER	silent_mutation	Average:40.583; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222921847	NA	7.73E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	9.18E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	3.64E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	2.47E-06	8.64E-10	mr1069	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	7.60E-06	mr1072	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	8.07E-08	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	7.49E-06	NA	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	2.65E-11	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	5.57E-07	mr1149	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	5.33E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	1.14E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	5.31E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	1.26E-09	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	6.68E-06	mr1441	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	8.50E-06	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	7.50E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	4.41E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	5.30E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	2.61E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	4.66E-07	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	2.16E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	6.24E-06	NA	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	6.98E-10	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	1.07E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	8.69E-06	mr1685	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	3.17E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	8.86E-07	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222921847	NA	3.30E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251