Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222906823:

Variant ID: vg1222906823 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22906823
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCAAAAATTGCCTCCTCGAAATTCCTCTTCCGACTCAAGTCTCCAAATCAAACTCTGAAATTCTATCCCTCTCTTTGAATCATCGCCAAATACTTCCCC[A/G]
GATCCAAAATATCCAAAACCCCATCTTGAATCCTCCGTCTACTCCTTCCTCTCATCGAGATCACAATTCCAAAATCTAAGTCAAATTCCAAGTTCAAATT

Reverse complement sequence

AATTTGAACTTGGAATTTGACTTAGATTTTGGAATTGTGATCTCGATGAGAGGAAGGAGTAGACGGAGGATTCAAGATGGGGTTTTGGATATTTTGGATC[T/C]
GGGGAAGTATTTGGCGATGATTCAAAGAGAGGGATAGAATTTCAGAGTTTGATTTGGAGACTTGAGTCGGAAGAGGAATTTCGAGGAGGCAATTTTTGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.80%	2.20%	11.43%	30.55%	NA
All Indica	2759	36.40%	0.10%	16.64%	46.79%	NA
All Japonica	1512	90.10%	6.20%	2.38%	1.32%	NA
Aus	269	42.80%	0.00%	14.87%	42.38%	NA
Indica I	595	69.10%	0.00%	9.41%	21.51%	NA
Indica II	465	15.30%	0.40%	14.62%	69.68%	NA
Indica III	913	30.90%	0.10%	22.23%	46.77%	NA
Indica Intermediate	786	30.70%	0.10%	16.79%	52.42%	NA
Temperate Japonica	767	95.80%	0.30%	2.22%	1.69%	NA
Tropical Japonica	504	79.00%	17.10%	2.98%	0.99%	NA
Japonica Intermediate	241	95.00%	2.50%	1.66%	0.83%	NA
VI/Aromatic	96	90.60%	0.00%	2.08%	7.29%	NA
Intermediate	90	76.70%	6.70%	3.33%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222906823	A -> DEL	N	N	silent_mutation	Average:12.517; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1222906823	A -> G	LOC_Os12g37310-LOC_Os12g37320	intergenic_region ; MODIFIER	silent_mutation	Average:12.517; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222906823	NA	4.80E-07	mr1073	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823	NA	4.31E-06	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823	NA	1.40E-06	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823	9.07E-07	8.20E-09	mr1068_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823	NA	2.20E-06	mr1078_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823	4.62E-06	2.19E-09	mr1090_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823	NA	2.03E-06	mr1094_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823	NA	1.14E-08	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823	NA	1.38E-07	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823	NA	2.06E-06	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823	NA	8.13E-06	mr1200_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823	NA	2.50E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251