\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222906823:

Variant ID: vg1222906823 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22906823
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCAAAAATTGCCTCCTCGAAATTCCTCTTCCGACTCAAGTCTCCAAATCAAACTCTGAAATTCTATCCCTCTCTTTGAATCATCGCCAAATACTTCCCC[A/G]
GATCCAAAATATCCAAAACCCCATCTTGAATCCTCCGTCTACTCCTTCCTCTCATCGAGATCACAATTCCAAAATCTAAGTCAAATTCCAAGTTCAAATT

Reverse complement sequence

AATTTGAACTTGGAATTTGACTTAGATTTTGGAATTGTGATCTCGATGAGAGGAAGGAGTAGACGGAGGATTCAAGATGGGGTTTTGGATATTTTGGATC[T/C]
GGGGAAGTATTTGGCGATGATTCAAAGAGAGGGATAGAATTTCAGAGTTTGATTTGGAGACTTGAGTCGGAAGAGGAATTTCGAGGAGGCAATTTTTGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 2.20% 11.43% 30.55% NA
All Indica  2759 36.40% 0.10% 16.64% 46.79% NA
All Japonica  1512 90.10% 6.20% 2.38% 1.32% NA
Aus  269 42.80% 0.00% 14.87% 42.38% NA
Indica I  595 69.10% 0.00% 9.41% 21.51% NA
Indica II  465 15.30% 0.40% 14.62% 69.68% NA
Indica III  913 30.90% 0.10% 22.23% 46.77% NA
Indica Intermediate  786 30.70% 0.10% 16.79% 52.42% NA
Temperate Japonica  767 95.80% 0.30% 2.22% 1.69% NA
Tropical Japonica  504 79.00% 17.10% 2.98% 0.99% NA
Japonica Intermediate  241 95.00% 2.50% 1.66% 0.83% NA
VI/Aromatic  96 90.60% 0.00% 2.08% 7.29% NA
Intermediate  90 76.70% 6.70% 3.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222906823 A -> DEL N N silent_mutation Average:12.517; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1222906823 A -> G LOC_Os12g37310-LOC_Os12g37320 intergenic_region ; MODIFIER silent_mutation Average:12.517; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222906823 NA 4.80E-07 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823 NA 4.31E-06 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823 NA 1.40E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823 9.07E-07 8.20E-09 mr1068_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823 NA 2.20E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823 4.62E-06 2.19E-09 mr1090_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823 NA 2.03E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823 NA 1.14E-08 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823 NA 1.38E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823 NA 2.06E-06 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823 NA 8.13E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222906823 NA 2.50E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251