Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222877771:

Variant ID: vg1222877771 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22877771
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

GAGCAGAAGAGGTAGTGACGATCTAATTAGCGACGGAAGAAGAAGAGGAGGAGGCGTAGCGGCAGAGTCCAAATTGGTGGTGGAGGGAGCATCTAGATCC[G/A]
GTCTAGAATAGAGAGGGGTGGAGTTGGCTTTCTCGGTGAGGAAGGGGAGCAGCCTAGCGGCGTCCAACAGCAGTGCCTAAGCATTGACTGCTCTTGTGTT

Reverse complement sequence

AACACAAGAGCAGTCAATGCTTAGGCACTGCTGTTGGACGCCGCTAGGCTGCTCCCCTTCCTCACCGAGAAAGCCAACTCCACCCCTCTCTATTCTAGAC[C/T]
GGATCTAGATGCTCCCTCCACCACCAATTTGGACTCTGCCGCTACGCCTCCTCCTCTTCTTCTTCCGTCGCTAATTAGATCGTCACTACCTCTTCTGCTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.30%	10.90%	5.76%	0.00%	NA
All Indica	2759	95.80%	0.90%	3.33%	0.00%	NA
All Japonica	1512	57.50%	31.60%	10.91%	0.00%	NA
Aus	269	98.10%	0.00%	1.86%	0.00%	NA
Indica I	595	84.90%	1.80%	13.28%	0.00%	NA
Indica II	465	97.60%	1.90%	0.43%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	0.50%	1.40%	0.00%	NA
Temperate Japonica	767	31.00%	53.50%	15.51%	0.00%	NA
Tropical Japonica	504	90.10%	5.40%	4.56%	0.00%	NA
Japonica Intermediate	241	73.40%	17.00%	9.54%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	13.30%	11.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222877771	G -> A	LOC_Os12g37280.1	upstream_gene_variant ; 112.0bp to feature; MODIFIER	silent_mutation	Average:71.899; most accessible tissue: Zhenshan97 young leaf, score: 88.878	N	N	N	N
vg1222877771	G -> A	LOC_Os12g37290.1	downstream_gene_variant ; 4428.0bp to feature; MODIFIER	silent_mutation	Average:71.899; most accessible tissue: Zhenshan97 young leaf, score: 88.878	N	N	N	N
vg1222877771	G -> A	LOC_Os12g37280-LOC_Os12g37290	intergenic_region ; MODIFIER	silent_mutation	Average:71.899; most accessible tissue: Zhenshan97 young leaf, score: 88.878	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222877771	NA	1.19E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	1.90E-06	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	7.89E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	1.21E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	9.10E-06	mr1149	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	6.68E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	1.42E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	3.39E-08	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	4.87E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	2.95E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	7.90E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	1.98E-07	NA	mr1670	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	3.39E-10	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	9.48E-06	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	1.10E-12	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	1.19E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	1.05E-09	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	NA	3.13E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771	7.18E-06	NA	mr1670_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251