\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222877771:

Variant ID: vg1222877771 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22877771
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCAGAAGAGGTAGTGACGATCTAATTAGCGACGGAAGAAGAAGAGGAGGAGGCGTAGCGGCAGAGTCCAAATTGGTGGTGGAGGGAGCATCTAGATCC[G/A]
GTCTAGAATAGAGAGGGGTGGAGTTGGCTTTCTCGGTGAGGAAGGGGAGCAGCCTAGCGGCGTCCAACAGCAGTGCCTAAGCATTGACTGCTCTTGTGTT

Reverse complement sequence

AACACAAGAGCAGTCAATGCTTAGGCACTGCTGTTGGACGCCGCTAGGCTGCTCCCCTTCCTCACCGAGAAAGCCAACTCCACCCCTCTCTATTCTAGAC[C/T]
GGATCTAGATGCTCCCTCCACCACCAATTTGGACTCTGCCGCTACGCCTCCTCCTCTTCTTCTTCCGTCGCTAATTAGATCGTCACTACCTCTTCTGCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 10.90% 5.76% 0.00% NA
All Indica  2759 95.80% 0.90% 3.33% 0.00% NA
All Japonica  1512 57.50% 31.60% 10.91% 0.00% NA
Aus  269 98.10% 0.00% 1.86% 0.00% NA
Indica I  595 84.90% 1.80% 13.28% 0.00% NA
Indica II  465 97.60% 1.90% 0.43% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 0.50% 1.40% 0.00% NA
Temperate Japonica  767 31.00% 53.50% 15.51% 0.00% NA
Tropical Japonica  504 90.10% 5.40% 4.56% 0.00% NA
Japonica Intermediate  241 73.40% 17.00% 9.54% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 13.30% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222877771 G -> A LOC_Os12g37280.1 upstream_gene_variant ; 112.0bp to feature; MODIFIER silent_mutation Average:71.899; most accessible tissue: Zhenshan97 young leaf, score: 88.878 N N N N
vg1222877771 G -> A LOC_Os12g37290.1 downstream_gene_variant ; 4428.0bp to feature; MODIFIER silent_mutation Average:71.899; most accessible tissue: Zhenshan97 young leaf, score: 88.878 N N N N
vg1222877771 G -> A LOC_Os12g37280-LOC_Os12g37290 intergenic_region ; MODIFIER silent_mutation Average:71.899; most accessible tissue: Zhenshan97 young leaf, score: 88.878 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222877771 NA 1.19E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 1.90E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 7.89E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 1.21E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 9.10E-06 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 6.68E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 1.42E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 3.39E-08 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 4.87E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 2.95E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 7.90E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 1.98E-07 NA mr1670 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 3.39E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 9.48E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 1.10E-12 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 1.19E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 1.05E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 NA 3.13E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877771 7.18E-06 NA mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251