Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222877698:

Variant ID: vg1222877698 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22877698
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.61, T: 0.39, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GATGGGGAAGAAGGGGGTGCTGCCACAGCTACCCGCACCCCTTTTGTGCTGCCTGCCCACATCACGGCGGCCGGAGCAGAAGAGGTAGTGACGATCTAAT[T/C]
AGCGACGGAAGAAGAAGAGGAGGAGGCGTAGCGGCAGAGTCCAAATTGGTGGTGGAGGGAGCATCTAGATCCGGTCTAGAATAGAGAGGGGTGGAGTTGG

Reverse complement sequence

CCAACTCCACCCCTCTCTATTCTAGACCGGATCTAGATGCTCCCTCCACCACCAATTTGGACTCTGCCGCTACGCCTCCTCCTCTTCTTCTTCCGTCGCT[A/G]
ATTAGATCGTCACTACCTCTTCTGCTCCGGCCGCCGTGATGTGGGCAGGCAGCACAAAAGGGGTGCGGGTAGCTGTGGCAGCACCCCCTTCTTCCCCATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 46.70% 0.08% 0.19% NA
All Indica  2759 26.30% 73.30% 0.14% 0.33% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 46.50% 53.50% 0.00% 0.00% NA
Indica I  595 66.10% 33.90% 0.00% 0.00% NA
Indica II  465 7.70% 91.80% 0.00% 0.43% NA
Indica III  913 14.10% 85.40% 0.11% 0.33% NA
Indica Intermediate  786 21.20% 77.90% 0.38% 0.51% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222877698 T -> C LOC_Os12g37280.1 upstream_gene_variant ; 39.0bp to feature; MODIFIER silent_mutation Average:72.731; most accessible tissue: Zhenshan97 young leaf, score: 89.226 N N N N
vg1222877698 T -> C LOC_Os12g37290.1 downstream_gene_variant ; 4501.0bp to feature; MODIFIER silent_mutation Average:72.731; most accessible tissue: Zhenshan97 young leaf, score: 89.226 N N N N
vg1222877698 T -> C LOC_Os12g37280-LOC_Os12g37290 intergenic_region ; MODIFIER silent_mutation Average:72.731; most accessible tissue: Zhenshan97 young leaf, score: 89.226 N N N N
vg1222877698 T -> DEL N N silent_mutation Average:72.731; most accessible tissue: Zhenshan97 young leaf, score: 89.226 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1222877698 T C 0.01 0.02 0.01 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222877698 NA 6.96E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 NA 3.78E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 6.61E-07 NA mr1028 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 NA 7.70E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 NA 4.56E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 NA 5.02E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 2.65E-06 NA mr1453 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 NA 2.48E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 NA 1.73E-07 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 NA 5.48E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 NA 7.71E-07 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 NA 1.80E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 NA 8.14E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 NA 4.23E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222877698 NA 4.81E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251