\
| Variant ID: vg1222847864 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22847864 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 74. )
ATTTGACTAGCAATAGTGCCCGTGCCTTGCAACGGAAAAAACACCGTTTGATAATGTGACACTTTAAAAACCTCAAATCGGTAAAAGTCAAGTTTAATTT[G/A]
ATATATTAACAAATAGGTAGAACTGACACTAATTTGATGAATTAGCATATGATTTAGAATTTATTTTTCAAGCCTACTTAGGAGTTTATCCAACGGATTT
AAATCCGTTGGATAAACTCCTAAGTAGGCTTGAAAAATAAATTCTAAATCATATGCTAATTCATCAAATTAGTGTCAGTTCTACCTATTTGTTAATATAT[C/T]
AAATTAAACTTGACTTTTACCGATTTGAGGTTTTTAAAGTGTCACATTATCAAACGGTGTTTTTTCCGTTGCAAGGCACGGGCACTATTGCTAGTCAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.40% | 4.60% | 0.53% | 22.47% | NA |
| All Indica | 2759 | 58.50% | 7.60% | 0.83% | 32.98% | NA |
| All Japonica | 1512 | 97.80% | 0.30% | 0.07% | 1.85% | NA |
| Aus | 269 | 56.10% | 0.00% | 0.00% | 43.87% | NA |
| Indica I | 595 | 81.30% | 0.00% | 0.34% | 18.32% | NA |
| Indica II | 465 | 27.70% | 28.80% | 1.51% | 41.94% | NA |
| Indica III | 913 | 65.20% | 1.10% | 0.77% | 32.97% | NA |
| Indica Intermediate | 786 | 51.80% | 8.50% | 0.89% | 38.80% | NA |
| Temperate Japonica | 767 | 96.20% | 0.70% | 0.13% | 3.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 92.20% | 3.30% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222847864 | G -> DEL | N | N | silent_mutation | Average:16.839; most accessible tissue: Callus, score: 35.295 | N | N | N | N |
| vg1222847864 | G -> A | LOC_Os12g37250.1 | upstream_gene_variant ; 753.0bp to feature; MODIFIER | silent_mutation | Average:16.839; most accessible tissue: Callus, score: 35.295 | N | N | N | N |
| vg1222847864 | G -> A | LOC_Os12g37240.1 | downstream_gene_variant ; 1803.0bp to feature; MODIFIER | silent_mutation | Average:16.839; most accessible tissue: Callus, score: 35.295 | N | N | N | N |
| vg1222847864 | G -> A | LOC_Os12g37240-LOC_Os12g37250 | intergenic_region ; MODIFIER | silent_mutation | Average:16.839; most accessible tissue: Callus, score: 35.295 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222847864 | NA | 2.45E-09 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222847864 | NA | 4.25E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222847864 | NA | 1.77E-09 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222847864 | NA | 5.00E-09 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222847864 | NA | 8.91E-08 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222847864 | NA | 4.35E-08 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222847864 | NA | 4.01E-10 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222847864 | 1.41E-06 | NA | mr1870_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222847864 | 4.96E-06 | NA | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222847864 | NA | 1.04E-06 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222847864 | NA | 8.97E-07 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |