Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1222847864:

Variant ID: vg1222847864 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22847864
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTGACTAGCAATAGTGCCCGTGCCTTGCAACGGAAAAAACACCGTTTGATAATGTGACACTTTAAAAACCTCAAATCGGTAAAAGTCAAGTTTAATTT[G/A]
ATATATTAACAAATAGGTAGAACTGACACTAATTTGATGAATTAGCATATGATTTAGAATTTATTTTTCAAGCCTACTTAGGAGTTTATCCAACGGATTT

Reverse complement sequence

AAATCCGTTGGATAAACTCCTAAGTAGGCTTGAAAAATAAATTCTAAATCATATGCTAATTCATCAAATTAGTGTCAGTTCTACCTATTTGTTAATATAT[C/T]
AAATTAAACTTGACTTTTACCGATTTGAGGTTTTTAAAGTGTCACATTATCAAACGGTGTTTTTTCCGTTGCAAGGCACGGGCACTATTGCTAGTCAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.40%	4.60%	0.53%	22.47%	NA
All Indica	2759	58.50%	7.60%	0.83%	32.98%	NA
All Japonica	1512	97.80%	0.30%	0.07%	1.85%	NA
Aus	269	56.10%	0.00%	0.00%	43.87%	NA
Indica I	595	81.30%	0.00%	0.34%	18.32%	NA
Indica II	465	27.70%	28.80%	1.51%	41.94%	NA
Indica III	913	65.20%	1.10%	0.77%	32.97%	NA
Indica Intermediate	786	51.80%	8.50%	0.89%	38.80%	NA
Temperate Japonica	767	96.20%	0.70%	0.13%	3.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	96.90%	0.00%	1.04%	2.08%	NA
Intermediate	90	92.20%	3.30%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222847864	G -> DEL	N	N	silent_mutation	Average:16.839; most accessible tissue: Callus, score: 35.295	N	N	N	N
vg1222847864	G -> A	LOC_Os12g37250.1	upstream_gene_variant ; 753.0bp to feature; MODIFIER	silent_mutation	Average:16.839; most accessible tissue: Callus, score: 35.295	N	N	N	N
vg1222847864	G -> A	LOC_Os12g37240.1	downstream_gene_variant ; 1803.0bp to feature; MODIFIER	silent_mutation	Average:16.839; most accessible tissue: Callus, score: 35.295	N	N	N	N
vg1222847864	G -> A	LOC_Os12g37240-LOC_Os12g37250	intergenic_region ; MODIFIER	silent_mutation	Average:16.839; most accessible tissue: Callus, score: 35.295	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222847864	NA	2.45E-09	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222847864	NA	4.25E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222847864	NA	1.77E-09	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222847864	NA	5.00E-09	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222847864	NA	8.91E-08	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222847864	NA	4.35E-08	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222847864	NA	4.01E-10	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222847864	1.41E-06	NA	mr1870_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222847864	4.96E-06	NA	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222847864	NA	1.04E-06	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222847864	NA	8.97E-07	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251