\
| Variant ID: vg1222744855 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22744855 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )
AATGCAACCCACTATGGTCGCTCTTAGGGAGTAGTAATTAAATCAGTGTTGCTGTCATATTTTGTTAGCACGAACACACATTTCAAATATCAATCCAATT[C/T]
GAGATCCAAAGAAAATAAGAAACCGGGAGCTAGGTATAAACGAATAAAACATTTCTCGTGACGCTTCAATCCTAATGAAATTGTTGTTGACAACAGGTAG
CTACCTGTTGTCAACAACAATTTCATTAGGATTGAAGCGTCACGAGAAATGTTTTATTCGTTTATACCTAGCTCCCGGTTTCTTATTTTCTTTGGATCTC[G/A]
AATTGGATTGATATTTGAAATGTGTGTTCGTGCTAACAAAATATGACAGCAACACTGATTTAATTACTACTCCCTAAGAGCGACCATAGTGGGTTGCATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 8.10% | 0.02% | 1.23% | NA |
| All Indica | 2759 | 84.20% | 13.70% | 0.04% | 2.10% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.40% | 12.30% | 0.00% | 7.31% | NA |
| Indica III | 913 | 78.80% | 20.80% | 0.00% | 0.44% | NA |
| Indica Intermediate | 786 | 83.20% | 14.10% | 0.13% | 2.54% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222744855 | C -> DEL | N | N | silent_mutation | Average:44.792; most accessible tissue: Zhenshan97 young leaf, score: 66.32 | N | N | N | N |
| vg1222744855 | C -> T | LOC_Os12g37120.1 | downstream_gene_variant ; 1000.0bp to feature; MODIFIER | silent_mutation | Average:44.792; most accessible tissue: Zhenshan97 young leaf, score: 66.32 | N | N | N | N |
| vg1222744855 | C -> T | LOC_Os12g37120-LOC_Os12g37130 | intergenic_region ; MODIFIER | silent_mutation | Average:44.792; most accessible tissue: Zhenshan97 young leaf, score: 66.32 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222744855 | 3.03E-06 | 3.02E-06 | mr1340 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222744855 | 2.15E-06 | 2.15E-06 | mr1429 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222744855 | NA | 9.53E-06 | mr1590 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222744855 | NA | 4.42E-06 | mr1616 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222744855 | NA | 8.66E-06 | mr1639 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222744855 | NA | 4.75E-06 | mr1964 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |