\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222744855:

Variant ID: vg1222744855 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22744855
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AATGCAACCCACTATGGTCGCTCTTAGGGAGTAGTAATTAAATCAGTGTTGCTGTCATATTTTGTTAGCACGAACACACATTTCAAATATCAATCCAATT[C/T]
GAGATCCAAAGAAAATAAGAAACCGGGAGCTAGGTATAAACGAATAAAACATTTCTCGTGACGCTTCAATCCTAATGAAATTGTTGTTGACAACAGGTAG

Reverse complement sequence

CTACCTGTTGTCAACAACAATTTCATTAGGATTGAAGCGTCACGAGAAATGTTTTATTCGTTTATACCTAGCTCCCGGTTTCTTATTTTCTTTGGATCTC[G/A]
AATTGGATTGATATTTGAAATGTGTGTTCGTGCTAACAAAATATGACAGCAACACTGATTTAATTACTACTCCCTAAGAGCGACCATAGTGGGTTGCATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 8.10% 0.02% 1.23% NA
All Indica  2759 84.20% 13.70% 0.04% 2.10% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 80.40% 12.30% 0.00% 7.31% NA
Indica III  913 78.80% 20.80% 0.00% 0.44% NA
Indica Intermediate  786 83.20% 14.10% 0.13% 2.54% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222744855 C -> DEL N N silent_mutation Average:44.792; most accessible tissue: Zhenshan97 young leaf, score: 66.32 N N N N
vg1222744855 C -> T LOC_Os12g37120.1 downstream_gene_variant ; 1000.0bp to feature; MODIFIER silent_mutation Average:44.792; most accessible tissue: Zhenshan97 young leaf, score: 66.32 N N N N
vg1222744855 C -> T LOC_Os12g37120-LOC_Os12g37130 intergenic_region ; MODIFIER silent_mutation Average:44.792; most accessible tissue: Zhenshan97 young leaf, score: 66.32 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222744855 3.03E-06 3.02E-06 mr1340 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222744855 2.15E-06 2.15E-06 mr1429 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222744855 NA 9.53E-06 mr1590 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222744855 NA 4.42E-06 mr1616 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222744855 NA 8.66E-06 mr1639 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222744855 NA 4.75E-06 mr1964 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251