Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222664248:

Variant ID: vg1222664248 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22664248
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


AATGGAAATAAGGTGGTTAACCAGAAATGCAAAAATACAATTTTATCTCAAAAGTAATTTTCTATCAAATATTTCTTTTAACTAAATTAACCAGTTGGAT[C/A,T]
AGAAGTAAAGAGAGATATATTCTTTCTGCAAATGTACTTCTAGGTACTCCCTCTGTCCCATAATATAATGGATTTTAGAGGGATGAACCTTATATTATGG

Reverse complement sequence

CCATAATATAAGGTTCATCCCTCTAAAATCCATTATATTATGGGACAGAGGGAGTACCTAGAAGTACATTTGCAGAAAGAATATATCTCTCTTTACTTCT[G/T,A]
ATCCAACTGGTTAATTTAGTTAAAAGAAATATTTGATAGAAAATTACTTTTGAGATAAAATTGTATTTTTGCATTTCTGGTTAACCACCTTATTTCCATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 0.60% 0.72% 1.46% T: 0.21%
All Indica  2759 97.00% 0.00% 0.40% 2.50% T: 0.07%
All Japonica  1512 96.80% 1.70% 1.52% 0.00% T: 0.07%
Aus  269 97.40% 0.00% 0.00% 0.00% T: 2.60%
Indica I  595 98.30% 0.00% 0.67% 1.01% NA
Indica II  465 92.00% 0.00% 0.00% 7.96% NA
Indica III  913 97.80% 0.00% 0.77% 1.42% NA
Indica Intermediate  786 98.10% 0.00% 0.00% 1.65% T: 0.25%
Temperate Japonica  767 94.00% 3.30% 2.74% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.00% 0.83% 0.00% T: 0.41%
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222664248 C -> DEL N N silent_mutation Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1222664248 C -> A LOC_Os12g36950.1 upstream_gene_variant ; 1648.0bp to feature; MODIFIER silent_mutation Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1222664248 C -> A LOC_Os12g36960.1 upstream_gene_variant ; 905.0bp to feature; MODIFIER silent_mutation Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1222664248 C -> A LOC_Os12g36950.3 upstream_gene_variant ; 1648.0bp to feature; MODIFIER silent_mutation Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1222664248 C -> A LOC_Os12g36970.1 downstream_gene_variant ; 3339.0bp to feature; MODIFIER silent_mutation Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1222664248 C -> A LOC_Os12g36960-LOC_Os12g36970 intergenic_region ; MODIFIER silent_mutation Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1222664248 C -> T LOC_Os12g36950.1 upstream_gene_variant ; 1648.0bp to feature; MODIFIER silent_mutation Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1222664248 C -> T LOC_Os12g36960.1 upstream_gene_variant ; 905.0bp to feature; MODIFIER silent_mutation Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1222664248 C -> T LOC_Os12g36950.3 upstream_gene_variant ; 1648.0bp to feature; MODIFIER silent_mutation Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1222664248 C -> T LOC_Os12g36970.1 downstream_gene_variant ; 3339.0bp to feature; MODIFIER silent_mutation Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1222664248 C -> T LOC_Os12g36960-LOC_Os12g36970 intergenic_region ; MODIFIER silent_mutation Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222664248 NA 1.56E-06 mr1219 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222664248 4.51E-07 8.25E-08 mr1201_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222664248 1.62E-06 1.27E-07 mr1219_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222664248 NA 1.17E-06 mr1274_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251