\
| Variant ID: vg1222664248 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22664248 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )
AATGGAAATAAGGTGGTTAACCAGAAATGCAAAAATACAATTTTATCTCAAAAGTAATTTTCTATCAAATATTTCTTTTAACTAAATTAACCAGTTGGAT[C/A,T]
AGAAGTAAAGAGAGATATATTCTTTCTGCAAATGTACTTCTAGGTACTCCCTCTGTCCCATAATATAATGGATTTTAGAGGGATGAACCTTATATTATGG
CCATAATATAAGGTTCATCCCTCTAAAATCCATTATATTATGGGACAGAGGGAGTACCTAGAAGTACATTTGCAGAAAGAATATATCTCTCTTTACTTCT[G/T,A]
ATCCAACTGGTTAATTTAGTTAAAAGAAATATTTGATAGAAAATTACTTTTGAGATAAAATTGTATTTTTGCATTTCTGGTTAACCACCTTATTTCCATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.10% | 0.60% | 0.72% | 1.46% | T: 0.21% |
| All Indica | 2759 | 97.00% | 0.00% | 0.40% | 2.50% | T: 0.07% |
| All Japonica | 1512 | 96.80% | 1.70% | 1.52% | 0.00% | T: 0.07% |
| Aus | 269 | 97.40% | 0.00% | 0.00% | 0.00% | T: 2.60% |
| Indica I | 595 | 98.30% | 0.00% | 0.67% | 1.01% | NA |
| Indica II | 465 | 92.00% | 0.00% | 0.00% | 7.96% | NA |
| Indica III | 913 | 97.80% | 0.00% | 0.77% | 1.42% | NA |
| Indica Intermediate | 786 | 98.10% | 0.00% | 0.00% | 1.65% | T: 0.25% |
| Temperate Japonica | 767 | 94.00% | 3.30% | 2.74% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.83% | 0.00% | T: 0.41% |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222664248 | C -> DEL | N | N | silent_mutation | Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1222664248 | C -> A | LOC_Os12g36950.1 | upstream_gene_variant ; 1648.0bp to feature; MODIFIER | silent_mutation | Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1222664248 | C -> A | LOC_Os12g36960.1 | upstream_gene_variant ; 905.0bp to feature; MODIFIER | silent_mutation | Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1222664248 | C -> A | LOC_Os12g36950.3 | upstream_gene_variant ; 1648.0bp to feature; MODIFIER | silent_mutation | Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1222664248 | C -> A | LOC_Os12g36970.1 | downstream_gene_variant ; 3339.0bp to feature; MODIFIER | silent_mutation | Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1222664248 | C -> A | LOC_Os12g36960-LOC_Os12g36970 | intergenic_region ; MODIFIER | silent_mutation | Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1222664248 | C -> T | LOC_Os12g36950.1 | upstream_gene_variant ; 1648.0bp to feature; MODIFIER | silent_mutation | Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1222664248 | C -> T | LOC_Os12g36960.1 | upstream_gene_variant ; 905.0bp to feature; MODIFIER | silent_mutation | Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1222664248 | C -> T | LOC_Os12g36950.3 | upstream_gene_variant ; 1648.0bp to feature; MODIFIER | silent_mutation | Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1222664248 | C -> T | LOC_Os12g36970.1 | downstream_gene_variant ; 3339.0bp to feature; MODIFIER | silent_mutation | Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1222664248 | C -> T | LOC_Os12g36960-LOC_Os12g36970 | intergenic_region ; MODIFIER | silent_mutation | Average:50.583; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222664248 | NA | 1.56E-06 | mr1219 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222664248 | 4.51E-07 | 8.25E-08 | mr1201_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222664248 | 1.62E-06 | 1.27E-07 | mr1219_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222664248 | NA | 1.17E-06 | mr1274_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |