\
| Variant ID: vg1222647123 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22647123 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 109. )
GTACTATTAATTAATGTTTAAAGTTGTCCTAAAATGTGATTTTCCACGAAGATAACGCACTCTGGTGGTGTTCTTTTAAGCAAGGTAGTACAAACGCAAA[G/A,T]
CGTGCACGACGTGTACACTTATCCTTATGATTGTGAACACACACAAACAGCTTATCCCTATAAGCATATCTGAAATACTTAGCCGGCATACTCTCTCCGT
ACGGAGAGAGTATGCCGGCTAAGTATTTCAGATATGCTTATAGGGATAAGCTGTTTGTGTGTGTTCACAATCATAAGGATAAGTGTACACGTCGTGCACG[C/T,A]
TTTGCGTTTGTACTACCTTGCTTAAAAGAACACCACCAGAGTGCGTTATCTTCGTGGAAAATCACATTTTAGGACAACTTTAAACATTAATTAATAGTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.80% | 4.70% | 1.08% | 36.12% | T: 0.36% |
| All Indica | 2759 | 29.80% | 7.50% | 1.78% | 60.38% | T: 0.54% |
| All Japonica | 1512 | 98.80% | 0.30% | 0.07% | 0.73% | T: 0.13% |
| Aus | 269 | 92.90% | 2.60% | 0.00% | 4.46% | NA |
| Indica I | 595 | 63.50% | 0.30% | 0.67% | 35.46% | NA |
| Indica II | 465 | 11.40% | 28.40% | 1.94% | 56.99% | T: 1.29% |
| Indica III | 913 | 17.20% | 0.40% | 1.64% | 80.18% | T: 0.55% |
| Indica Intermediate | 786 | 29.60% | 8.90% | 2.67% | 58.27% | T: 0.51% |
| Temperate Japonica | 767 | 99.00% | 0.40% | 0.13% | 0.26% | T: 0.26% |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 81.10% | 2.20% | 1.11% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222647123 | G -> DEL | N | N | silent_mutation | Average:42.437; most accessible tissue: Callus, score: 85.994 | N | N | N | N |
| vg1222647123 | G -> A | LOC_Os12g36940.1 | upstream_gene_variant ; 997.0bp to feature; MODIFIER | silent_mutation | Average:42.437; most accessible tissue: Callus, score: 85.994 | N | N | N | N |
| vg1222647123 | G -> A | LOC_Os12g36930.1 | downstream_gene_variant ; 4036.0bp to feature; MODIFIER | silent_mutation | Average:42.437; most accessible tissue: Callus, score: 85.994 | N | N | N | N |
| vg1222647123 | G -> A | LOC_Os12g36930-LOC_Os12g36940 | intergenic_region ; MODIFIER | silent_mutation | Average:42.437; most accessible tissue: Callus, score: 85.994 | N | N | N | N |
| vg1222647123 | G -> T | LOC_Os12g36940.1 | upstream_gene_variant ; 997.0bp to feature; MODIFIER | silent_mutation | Average:42.437; most accessible tissue: Callus, score: 85.994 | N | N | N | N |
| vg1222647123 | G -> T | LOC_Os12g36930.1 | downstream_gene_variant ; 4036.0bp to feature; MODIFIER | silent_mutation | Average:42.437; most accessible tissue: Callus, score: 85.994 | N | N | N | N |
| vg1222647123 | G -> T | LOC_Os12g36930-LOC_Os12g36940 | intergenic_region ; MODIFIER | silent_mutation | Average:42.437; most accessible tissue: Callus, score: 85.994 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222647123 | NA | 4.85E-06 | mr1268 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222647123 | NA | 4.30E-09 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222647123 | NA | 2.75E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222647123 | NA | 1.19E-09 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222647123 | NA | 1.77E-09 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222647123 | NA | 3.60E-08 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222647123 | NA | 6.15E-06 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222647123 | NA | 4.54E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222647123 | NA | 2.99E-09 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222647123 | 2.08E-06 | NA | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222647123 | 2.67E-06 | NA | mr1870_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |