\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222647123:

Variant ID: vg1222647123 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22647123
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GTACTATTAATTAATGTTTAAAGTTGTCCTAAAATGTGATTTTCCACGAAGATAACGCACTCTGGTGGTGTTCTTTTAAGCAAGGTAGTACAAACGCAAA[G/A,T]
CGTGCACGACGTGTACACTTATCCTTATGATTGTGAACACACACAAACAGCTTATCCCTATAAGCATATCTGAAATACTTAGCCGGCATACTCTCTCCGT

Reverse complement sequence

ACGGAGAGAGTATGCCGGCTAAGTATTTCAGATATGCTTATAGGGATAAGCTGTTTGTGTGTGTTCACAATCATAAGGATAAGTGTACACGTCGTGCACG[C/T,A]
TTTGCGTTTGTACTACCTTGCTTAAAAGAACACCACCAGAGTGCGTTATCTTCGTGGAAAATCACATTTTAGGACAACTTTAAACATTAATTAATAGTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 4.70% 1.08% 36.12% T: 0.36%
All Indica  2759 29.80% 7.50% 1.78% 60.38% T: 0.54%
All Japonica  1512 98.80% 0.30% 0.07% 0.73% T: 0.13%
Aus  269 92.90% 2.60% 0.00% 4.46% NA
Indica I  595 63.50% 0.30% 0.67% 35.46% NA
Indica II  465 11.40% 28.40% 1.94% 56.99% T: 1.29%
Indica III  913 17.20% 0.40% 1.64% 80.18% T: 0.55%
Indica Intermediate  786 29.60% 8.90% 2.67% 58.27% T: 0.51%
Temperate Japonica  767 99.00% 0.40% 0.13% 0.26% T: 0.26%
Tropical Japonica  504 98.80% 0.00% 0.00% 1.19% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 81.10% 2.20% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222647123 G -> DEL N N silent_mutation Average:42.437; most accessible tissue: Callus, score: 85.994 N N N N
vg1222647123 G -> A LOC_Os12g36940.1 upstream_gene_variant ; 997.0bp to feature; MODIFIER silent_mutation Average:42.437; most accessible tissue: Callus, score: 85.994 N N N N
vg1222647123 G -> A LOC_Os12g36930.1 downstream_gene_variant ; 4036.0bp to feature; MODIFIER silent_mutation Average:42.437; most accessible tissue: Callus, score: 85.994 N N N N
vg1222647123 G -> A LOC_Os12g36930-LOC_Os12g36940 intergenic_region ; MODIFIER silent_mutation Average:42.437; most accessible tissue: Callus, score: 85.994 N N N N
vg1222647123 G -> T LOC_Os12g36940.1 upstream_gene_variant ; 997.0bp to feature; MODIFIER silent_mutation Average:42.437; most accessible tissue: Callus, score: 85.994 N N N N
vg1222647123 G -> T LOC_Os12g36930.1 downstream_gene_variant ; 4036.0bp to feature; MODIFIER silent_mutation Average:42.437; most accessible tissue: Callus, score: 85.994 N N N N
vg1222647123 G -> T LOC_Os12g36930-LOC_Os12g36940 intergenic_region ; MODIFIER silent_mutation Average:42.437; most accessible tissue: Callus, score: 85.994 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222647123 NA 4.85E-06 mr1268 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222647123 NA 4.30E-09 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222647123 NA 2.75E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222647123 NA 1.19E-09 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222647123 NA 1.77E-09 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222647123 NA 3.60E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222647123 NA 6.15E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222647123 NA 4.54E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222647123 NA 2.99E-09 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222647123 2.08E-06 NA mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222647123 2.67E-06 NA mr1870_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251