\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222579507:

Variant ID: vg1222579507 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22579507
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, A: 0.13, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAACATTTGGCTTTGACTTATTCTTTTTACGCAAATTAAACAAAGTGATATGGTTGAGGGATGTGAATTAGATTCGGGTTATAGTTGAGGGACTCCAA[T/A]
ATAGACTTTTACCACTACAATGCCAGTAGTAAATGGGCCTATATTGGGCTTGGAATCTTTACATATGACTCTCAATGGATTTTTTCCCAAATTTTCATGC

Reverse complement sequence

GCATGAAAATTTGGGAAAAAATCCATTGAGAGTCATATGTAAAGATTCCAAGCCCAATATAGGCCCATTTACTACTGGCATTGTAGTGGTAAAAGTCTAT[A/T]
TTGGAGTCCCTCAACTATAACCCGAATCTAATTCACATCCCTCAACCATATCACTTTGTTTAATTTGCGTAAAAAGAATAAGTCAAAGCCAAATGTTAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.30% 21.60% 0.11% 0.00% NA
All Indica  2759 63.70% 36.20% 0.11% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 68.70% 30.90% 0.34% 0.00% NA
Indica II  465 35.10% 64.90% 0.00% 0.00% NA
Indica III  913 81.50% 18.40% 0.11% 0.00% NA
Indica Intermediate  786 56.10% 43.90% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222579507 T -> A LOC_Os12g36830.1 upstream_gene_variant ; 1271.0bp to feature; MODIFIER silent_mutation Average:87.461; most accessible tissue: Callus, score: 97.159 N N N N
vg1222579507 T -> A LOC_Os12g36810.1 downstream_gene_variant ; 3218.0bp to feature; MODIFIER silent_mutation Average:87.461; most accessible tissue: Callus, score: 97.159 N N N N
vg1222579507 T -> A LOC_Os12g36820.1 downstream_gene_variant ; 772.0bp to feature; MODIFIER silent_mutation Average:87.461; most accessible tissue: Callus, score: 97.159 N N N N
vg1222579507 T -> A LOC_Os12g36820-LOC_Os12g36830 intergenic_region ; MODIFIER silent_mutation Average:87.461; most accessible tissue: Callus, score: 97.159 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1222579507 T A -0.15 -0.15 -0.11 -0.11 -0.1 -0.12

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222579507 NA 4.16E-08 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 NA 7.14E-17 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 NA 6.79E-09 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 NA 2.86E-07 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 8.85E-06 NA mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 NA 3.30E-08 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 NA 2.67E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 NA 8.18E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 NA 1.78E-16 mr1031 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 NA 3.12E-08 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 NA 1.67E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 NA 1.49E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 NA 1.86E-16 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 NA 4.26E-08 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222579507 NA 3.75E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251