\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222577692:

Variant ID: vg1222577692 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22577692
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTCACGGCGGCTAGATTAAGAGGGCCGCTAGCAAAGATACAATTATTTTTGCTGGCGGACCTCTTATGTGACAGCCAACGAAGATCTATTTTCGCTGG[T/C]
GGTCGGCTAAGAGCGTTAGGAAAAACGCCCTACAGGCGCTATAAAAGAATGGTCTATCTATCTACAGGAAAATCCCACTCAAGAAGGAGGGAGATGGGAA

Reverse complement sequence

TTCCCATCTCCCTCCTTCTTGAGTGGGATTTTCCTGTAGATAGATAGACCATTCTTTTATAGCGCCTGTAGGGCGTTTTTCCTAACGCTCTTAGCCGACC[A/G]
CCAGCGAAAATAGATCTTCGTTGGCTGTCACATAAGAGGTCCGCCAGCAAAAATAATTGTATCTTTGCTAGCGGCCCTCTTAATCTAGCCGCCGTGAAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 21.50% 0.11% 0.00% NA
All Indica  2759 63.80% 36.00% 0.14% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 68.90% 30.90% 0.17% 0.00% NA
Indica II  465 35.30% 64.50% 0.22% 0.00% NA
Indica III  913 81.50% 18.50% 0.00% 0.00% NA
Indica Intermediate  786 56.40% 43.40% 0.25% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222577692 T -> C LOC_Os12g36820.1 upstream_gene_variant ; 503.0bp to feature; MODIFIER silent_mutation Average:71.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg1222577692 T -> C LOC_Os12g36830.1 upstream_gene_variant ; 3086.0bp to feature; MODIFIER silent_mutation Average:71.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg1222577692 T -> C LOC_Os12g36810.1 downstream_gene_variant ; 1403.0bp to feature; MODIFIER silent_mutation Average:71.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg1222577692 T -> C LOC_Os12g36810-LOC_Os12g36820 intergenic_region ; MODIFIER silent_mutation Average:71.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222577692 NA 3.42E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 1.65E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 5.36E-06 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 5.23E-08 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 4.81E-06 mr1011 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 1.01E-16 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 7.10E-06 1.13E-09 mr1013 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 3.26E-07 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 5.54E-08 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 3.28E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 7.46E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 7.61E-16 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 2.20E-08 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 3.64E-15 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 4.11E-07 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 4.43E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 2.27E-06 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 3.91E-16 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 1.80E-08 mr1056 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 NA 4.59E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222577692 3.78E-06 3.78E-06 mr1966 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251