\
| Variant ID: vg1222577692 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22577692 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 108. )
TCTTCACGGCGGCTAGATTAAGAGGGCCGCTAGCAAAGATACAATTATTTTTGCTGGCGGACCTCTTATGTGACAGCCAACGAAGATCTATTTTCGCTGG[T/C]
GGTCGGCTAAGAGCGTTAGGAAAAACGCCCTACAGGCGCTATAAAAGAATGGTCTATCTATCTACAGGAAAATCCCACTCAAGAAGGAGGGAGATGGGAA
TTCCCATCTCCCTCCTTCTTGAGTGGGATTTTCCTGTAGATAGATAGACCATTCTTTTATAGCGCCTGTAGGGCGTTTTTCCTAACGCTCTTAGCCGACC[A/G]
CCAGCGAAAATAGATCTTCGTTGGCTGTCACATAAGAGGTCCGCCAGCAAAAATAATTGTATCTTTGCTAGCGGCCCTCTTAATCTAGCCGCCGTGAAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.40% | 21.50% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 63.80% | 36.00% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 68.90% | 30.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 35.30% | 64.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 81.50% | 18.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 56.40% | 43.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222577692 | T -> C | LOC_Os12g36820.1 | upstream_gene_variant ; 503.0bp to feature; MODIFIER | silent_mutation | Average:71.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg1222577692 | T -> C | LOC_Os12g36830.1 | upstream_gene_variant ; 3086.0bp to feature; MODIFIER | silent_mutation | Average:71.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg1222577692 | T -> C | LOC_Os12g36810.1 | downstream_gene_variant ; 1403.0bp to feature; MODIFIER | silent_mutation | Average:71.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg1222577692 | T -> C | LOC_Os12g36810-LOC_Os12g36820 | intergenic_region ; MODIFIER | silent_mutation | Average:71.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222577692 | NA | 3.42E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 1.65E-06 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 5.36E-06 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 5.23E-08 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 4.81E-06 | mr1011 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 1.01E-16 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | 7.10E-06 | 1.13E-09 | mr1013 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 3.26E-07 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 5.54E-08 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 3.28E-06 | mr1021 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 7.46E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 7.61E-16 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 2.20E-08 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 3.64E-15 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 4.11E-07 | mr1034 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 4.43E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 2.27E-06 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 3.91E-16 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 1.80E-08 | mr1056 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | NA | 4.59E-06 | mr1872 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222577692 | 3.78E-06 | 3.78E-06 | mr1966 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |