\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222506866:

Variant ID: vg1222506866 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22506866
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGCGCAAGCGCTACCATTAACATAACTCCTTTCAGCCCGATCTAACTCTTTTACCACTCATCCGATCACCAATTCACCACTACCCCTTCTCCGTACATC[G/A]
ATAGAAAAATTAGTACAATTTCATGTACAAATAATTGGGGTCTGTCTTGAACCCCACGACTTATTGAACCTAGACTAAAAATGATCTTTAGTCACGGTTG

Reverse complement sequence

CAACCGTGACTAAAGATCATTTTTAGTCTAGGTTCAATAAGTCGTGGGGTTCAAGACAGACCCCAATTATTTGTACATGAAATTGTACTAATTTTTCTAT[C/T]
GATGTACGGAGAAGGGGTAGTGGTGAATTGGTGATCGGATGAGTGGTAAAAGAGTTAGATCGGGCTGAAAGGAGTTATGTTAATGGTAGCGCTTGCGCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 3.30% 6.90% 26.49% NA
All Indica  2759 51.50% 4.40% 10.47% 33.56% NA
All Japonica  1512 87.00% 0.30% 0.60% 12.10% NA
Aus  269 34.20% 9.70% 8.55% 47.58% NA
Indica I  595 68.20% 2.50% 9.75% 19.50% NA
Indica II  465 73.10% 0.90% 4.52% 21.51% NA
Indica III  913 28.10% 8.50% 14.57% 48.74% NA
Indica Intermediate  786 53.30% 3.20% 9.80% 33.72% NA
Temperate Japonica  767 92.00% 0.00% 0.52% 7.43% NA
Tropical Japonica  504 78.00% 0.80% 0.99% 20.24% NA
Japonica Intermediate  241 89.60% 0.40% 0.00% 9.96% NA
VI/Aromatic  96 90.60% 0.00% 2.08% 7.29% NA
Intermediate  90 86.70% 1.10% 3.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222506866 G -> DEL N N silent_mutation Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N
vg1222506866 G -> A LOC_Os12g36730.1 upstream_gene_variant ; 4369.0bp to feature; MODIFIER silent_mutation Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N
vg1222506866 G -> A LOC_Os12g36740.1 upstream_gene_variant ; 855.0bp to feature; MODIFIER silent_mutation Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N
vg1222506866 G -> A LOC_Os12g36740.2 upstream_gene_variant ; 857.0bp to feature; MODIFIER silent_mutation Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N
vg1222506866 G -> A LOC_Os12g36735.1 downstream_gene_variant ; 937.0bp to feature; MODIFIER silent_mutation Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N
vg1222506866 G -> A LOC_Os12g36750.1 downstream_gene_variant ; 4916.0bp to feature; MODIFIER silent_mutation Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N
vg1222506866 G -> A LOC_Os12g36750.3 downstream_gene_variant ; 4623.0bp to feature; MODIFIER silent_mutation Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N
vg1222506866 G -> A LOC_Os12g36750.2 downstream_gene_variant ; 4916.0bp to feature; MODIFIER silent_mutation Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N
vg1222506866 G -> A LOC_Os12g36735-LOC_Os12g36740 intergenic_region ; MODIFIER silent_mutation Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222506866 NA 7.02E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222506866 NA 1.77E-06 mr1543_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251