Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1222506866:

Variant ID: vg1222506866 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22506866
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGCGCAAGCGCTACCATTAACATAACTCCTTTCAGCCCGATCTAACTCTTTTACCACTCATCCGATCACCAATTCACCACTACCCCTTCTCCGTACATC[G/A]
ATAGAAAAATTAGTACAATTTCATGTACAAATAATTGGGGTCTGTCTTGAACCCCACGACTTATTGAACCTAGACTAAAAATGATCTTTAGTCACGGTTG

Reverse complement sequence

CAACCGTGACTAAAGATCATTTTTAGTCTAGGTTCAATAAGTCGTGGGGTTCAAGACAGACCCCAATTATTTGTACATGAAATTGTACTAATTTTTCTAT[C/T]
GATGTACGGAGAAGGGGTAGTGGTGAATTGGTGATCGGATGAGTGGTAAAAGAGTTAGATCGGGCTGAAAGGAGTTATGTTAATGGTAGCGCTTGCGCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	3.30%	6.90%	26.49%	NA
All Indica	2759	51.50%	4.40%	10.47%	33.56%	NA
All Japonica	1512	87.00%	0.30%	0.60%	12.10%	NA
Aus	269	34.20%	9.70%	8.55%	47.58%	NA
Indica I	595	68.20%	2.50%	9.75%	19.50%	NA
Indica II	465	73.10%	0.90%	4.52%	21.51%	NA
Indica III	913	28.10%	8.50%	14.57%	48.74%	NA
Indica Intermediate	786	53.30%	3.20%	9.80%	33.72%	NA
Temperate Japonica	767	92.00%	0.00%	0.52%	7.43%	NA
Tropical Japonica	504	78.00%	0.80%	0.99%	20.24%	NA
Japonica Intermediate	241	89.60%	0.40%	0.00%	9.96%	NA
VI/Aromatic	96	90.60%	0.00%	2.08%	7.29%	NA
Intermediate	90	86.70%	1.10%	3.33%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222506866	G -> DEL	N	N	silent_mutation	Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg1222506866	G -> A	LOC_Os12g36730.1	upstream_gene_variant ; 4369.0bp to feature; MODIFIER	silent_mutation	Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg1222506866	G -> A	LOC_Os12g36740.1	upstream_gene_variant ; 855.0bp to feature; MODIFIER	silent_mutation	Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg1222506866	G -> A	LOC_Os12g36740.2	upstream_gene_variant ; 857.0bp to feature; MODIFIER	silent_mutation	Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg1222506866	G -> A	LOC_Os12g36735.1	downstream_gene_variant ; 937.0bp to feature; MODIFIER	silent_mutation	Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg1222506866	G -> A	LOC_Os12g36750.1	downstream_gene_variant ; 4916.0bp to feature; MODIFIER	silent_mutation	Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg1222506866	G -> A	LOC_Os12g36750.3	downstream_gene_variant ; 4623.0bp to feature; MODIFIER	silent_mutation	Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg1222506866	G -> A	LOC_Os12g36750.2	downstream_gene_variant ; 4916.0bp to feature; MODIFIER	silent_mutation	Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg1222506866	G -> A	LOC_Os12g36735-LOC_Os12g36740	intergenic_region ; MODIFIER	silent_mutation	Average:59.061; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222506866	NA	7.02E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222506866	NA	1.77E-06	mr1543_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251