\
| Variant ID: vg1222488666 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22488666 |
| Reference Allele: C | Alternative Allele: G,T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGAGGCTTGGTGGACCTAGCATTATATAATGGCTAGTACATGAAAAAAAAGGTTGTTGATTAGGGGAAGAAATCAGCTAAGTACCTGAGTTAGTTCATCA[C/G,T]
CATCGTATTTCGAGCGCTGCTTGATTAGGATAGTCCTTAAGTGCCTCTCTAACAACAGCCTTGCTGCTTGAATAAATGGTTGCATGCCGAAGGGAGTGGA
TCCACTCCCTTCGGCATGCAACCATTTATTCAAGCAGCAAGGCTGTTGTTAGAGAGGCACTTAAGGACTATCCTAATCAAGCAGCGCTCGAAATACGATG[G/C,A]
TGATGAACTAACTCAGGTACTTAGCTGATTTCTTCCCCTAATCAACAACCTTTTTTTTCATGTACTAGCCATTATATAATGCTAGGTCCACCAAGCCTCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.60% | 13.60% | 4.76% | 1.27% | G: 4.72% |
| All Indica | 2759 | 61.00% | 21.00% | 7.87% | 2.17% | G: 7.97% |
| All Japonica | 1512 | 96.40% | 3.10% | 0.46% | 0.00% | NA |
| Aus | 269 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 68.90% | 22.70% | 4.03% | 3.19% | G: 1.18% |
| Indica II | 465 | 58.70% | 18.50% | 11.18% | 0.86% | G: 10.75% |
| Indica III | 913 | 54.80% | 23.70% | 9.31% | 1.53% | G: 10.73% |
| Indica Intermediate | 786 | 63.60% | 18.10% | 7.12% | 2.93% | G: 8.27% |
| Temperate Japonica | 767 | 96.10% | 3.30% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 5.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 2.10% | 1.04% | 0.00% | G: 3.12% |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222488666 | C -> DEL | N | N | silent_mutation | Average:46.486; most accessible tissue: Minghui63 root, score: 69.846 | N | N | N | N |
| vg1222488666 | C -> G | LOC_Os12g36720.1 | 3_prime_UTR_variant ; 279.0bp to feature; MODIFIER | silent_mutation | Average:46.486; most accessible tissue: Minghui63 root, score: 69.846 | N | N | N | N |
| vg1222488666 | C -> G | LOC_Os12g36710.1 | upstream_gene_variant ; 4062.0bp to feature; MODIFIER | silent_mutation | Average:46.486; most accessible tissue: Minghui63 root, score: 69.846 | N | N | N | N |
| vg1222488666 | C -> T | LOC_Os12g36720.1 | 3_prime_UTR_variant ; 279.0bp to feature; MODIFIER | silent_mutation | Average:46.486; most accessible tissue: Minghui63 root, score: 69.846 | N | N | N | N |
| vg1222488666 | C -> T | LOC_Os12g36710.1 | upstream_gene_variant ; 4062.0bp to feature; MODIFIER | silent_mutation | Average:46.486; most accessible tissue: Minghui63 root, score: 69.846 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222488666 | NA | 7.61E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222488666 | NA | 9.13E-06 | mr1296_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222488666 | NA | 3.45E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222488666 | NA | 8.29E-07 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222488666 | 6.50E-06 | 4.14E-11 | mr1446_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222488666 | NA | 7.76E-09 | mr1446_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222488666 | NA | 2.78E-06 | mr1899_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222488666 | NA | 2.97E-06 | mr1899_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |