\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222488666:

Variant ID: vg1222488666 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22488666
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGGCTTGGTGGACCTAGCATTATATAATGGCTAGTACATGAAAAAAAAGGTTGTTGATTAGGGGAAGAAATCAGCTAAGTACCTGAGTTAGTTCATCA[C/G,T]
CATCGTATTTCGAGCGCTGCTTGATTAGGATAGTCCTTAAGTGCCTCTCTAACAACAGCCTTGCTGCTTGAATAAATGGTTGCATGCCGAAGGGAGTGGA

Reverse complement sequence

TCCACTCCCTTCGGCATGCAACCATTTATTCAAGCAGCAAGGCTGTTGTTAGAGAGGCACTTAAGGACTATCCTAATCAAGCAGCGCTCGAAATACGATG[G/C,A]
TGATGAACTAACTCAGGTACTTAGCTGATTTCTTCCCCTAATCAACAACCTTTTTTTTCATGTACTAGCCATTATATAATGCTAGGTCCACCAAGCCTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 13.60% 4.76% 1.27% G: 4.72%
All Indica  2759 61.00% 21.00% 7.87% 2.17% G: 7.97%
All Japonica  1512 96.40% 3.10% 0.46% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 68.90% 22.70% 4.03% 3.19% G: 1.18%
Indica II  465 58.70% 18.50% 11.18% 0.86% G: 10.75%
Indica III  913 54.80% 23.70% 9.31% 1.53% G: 10.73%
Indica Intermediate  786 63.60% 18.10% 7.12% 2.93% G: 8.27%
Temperate Japonica  767 96.10% 3.30% 0.65% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 5.80% 0.83% 0.00% NA
VI/Aromatic  96 93.80% 2.10% 1.04% 0.00% G: 3.12%
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222488666 C -> DEL N N silent_mutation Average:46.486; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg1222488666 C -> G LOC_Os12g36720.1 3_prime_UTR_variant ; 279.0bp to feature; MODIFIER silent_mutation Average:46.486; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg1222488666 C -> G LOC_Os12g36710.1 upstream_gene_variant ; 4062.0bp to feature; MODIFIER silent_mutation Average:46.486; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg1222488666 C -> T LOC_Os12g36720.1 3_prime_UTR_variant ; 279.0bp to feature; MODIFIER silent_mutation Average:46.486; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg1222488666 C -> T LOC_Os12g36710.1 upstream_gene_variant ; 4062.0bp to feature; MODIFIER silent_mutation Average:46.486; most accessible tissue: Minghui63 root, score: 69.846 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222488666 NA 7.61E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488666 NA 9.13E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488666 NA 3.45E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488666 NA 8.29E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488666 6.50E-06 4.14E-11 mr1446_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488666 NA 7.76E-09 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488666 NA 2.78E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488666 NA 2.97E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251