\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222487174:

Variant ID: vg1222487174 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22487174
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TCATGTTCACAATATAGATAGGAAAAAAAAACATTTATAACCAAGTCACTGGCATCATAATATATATGCCTTTTTTTTTGTTGAAACAATTCATTGAGGT[A/G]
CATACACCAAAACAATAATGAATATGAAACACTGCTAGAGCATTAGAGATTTGCTGCATAAAAATGCAGAATCAGCACCCGTTCATCCTCAATCACAACT

Reverse complement sequence

AGTTGTGATTGAGGATGAACGGGTGCTGATTCTGCATTTTTATGCAGCAAATCTCTAATGCTCTAGCAGTGTTTCATATTCATTATTGTTTTGGTGTATG[T/C]
ACCTCAATGAATTGTTTCAACAAAAAAAAAGGCATATATATTATGATGCCAGTGACTTGGTTATAAATGTTTTTTTTTCCTATCTATATTGTGAACATGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 12.20% 1.06% 0.34% NA
All Indica  2759 77.10% 20.60% 1.74% 0.58% NA
All Japonica  1512 99.20% 0.70% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 87.20% 10.40% 2.02% 0.34% NA
Indica II  465 89.00% 9.50% 1.29% 0.22% NA
Indica III  913 62.40% 34.60% 1.53% 1.42% NA
Indica Intermediate  786 79.50% 18.40% 2.04% 0.00% NA
Temperate Japonica  767 99.10% 0.70% 0.26% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222487174 A -> DEL N N silent_mutation Average:46.465; most accessible tissue: Minghui63 flower, score: 64.266 N N N N
vg1222487174 A -> G LOC_Os12g36700.1 upstream_gene_variant ; 4351.0bp to feature; MODIFIER silent_mutation Average:46.465; most accessible tissue: Minghui63 flower, score: 64.266 N N N N
vg1222487174 A -> G LOC_Os12g36710.1 upstream_gene_variant ; 2570.0bp to feature; MODIFIER silent_mutation Average:46.465; most accessible tissue: Minghui63 flower, score: 64.266 N N N N
vg1222487174 A -> G LOC_Os12g36720.1 downstream_gene_variant ; 163.0bp to feature; MODIFIER silent_mutation Average:46.465; most accessible tissue: Minghui63 flower, score: 64.266 N N N N
vg1222487174 A -> G LOC_Os12g36710-LOC_Os12g36720 intergenic_region ; MODIFIER silent_mutation Average:46.465; most accessible tissue: Minghui63 flower, score: 64.266 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222487174 9.57E-07 1.06E-09 mr1446_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222487174 4.48E-07 6.65E-08 mr1446_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222487174 NA 6.10E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251