\
| Variant ID: vg1222487174 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22487174 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 101. )
TCATGTTCACAATATAGATAGGAAAAAAAAACATTTATAACCAAGTCACTGGCATCATAATATATATGCCTTTTTTTTTGTTGAAACAATTCATTGAGGT[A/G]
CATACACCAAAACAATAATGAATATGAAACACTGCTAGAGCATTAGAGATTTGCTGCATAAAAATGCAGAATCAGCACCCGTTCATCCTCAATCACAACT
AGTTGTGATTGAGGATGAACGGGTGCTGATTCTGCATTTTTATGCAGCAAATCTCTAATGCTCTAGCAGTGTTTCATATTCATTATTGTTTTGGTGTATG[T/C]
ACCTCAATGAATTGTTTCAACAAAAAAAAAGGCATATATATTATGATGCCAGTGACTTGGTTATAAATGTTTTTTTTTCCTATCTATATTGTGAACATGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.40% | 12.20% | 1.06% | 0.34% | NA |
| All Indica | 2759 | 77.10% | 20.60% | 1.74% | 0.58% | NA |
| All Japonica | 1512 | 99.20% | 0.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.20% | 10.40% | 2.02% | 0.34% | NA |
| Indica II | 465 | 89.00% | 9.50% | 1.29% | 0.22% | NA |
| Indica III | 913 | 62.40% | 34.60% | 1.53% | 1.42% | NA |
| Indica Intermediate | 786 | 79.50% | 18.40% | 2.04% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.70% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222487174 | A -> DEL | N | N | silent_mutation | Average:46.465; most accessible tissue: Minghui63 flower, score: 64.266 | N | N | N | N |
| vg1222487174 | A -> G | LOC_Os12g36700.1 | upstream_gene_variant ; 4351.0bp to feature; MODIFIER | silent_mutation | Average:46.465; most accessible tissue: Minghui63 flower, score: 64.266 | N | N | N | N |
| vg1222487174 | A -> G | LOC_Os12g36710.1 | upstream_gene_variant ; 2570.0bp to feature; MODIFIER | silent_mutation | Average:46.465; most accessible tissue: Minghui63 flower, score: 64.266 | N | N | N | N |
| vg1222487174 | A -> G | LOC_Os12g36720.1 | downstream_gene_variant ; 163.0bp to feature; MODIFIER | silent_mutation | Average:46.465; most accessible tissue: Minghui63 flower, score: 64.266 | N | N | N | N |
| vg1222487174 | A -> G | LOC_Os12g36710-LOC_Os12g36720 | intergenic_region ; MODIFIER | silent_mutation | Average:46.465; most accessible tissue: Minghui63 flower, score: 64.266 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222487174 | 9.57E-07 | 1.06E-09 | mr1446_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222487174 | 4.48E-07 | 6.65E-08 | mr1446_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222487174 | NA | 6.10E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |