Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222473124:

Variant ID: vg1222473124 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22473124
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCTTTTAAGTGGTAGACTGCTAGTCTTTCTTTTCTGTAGGGTATGCCACTACTTCAGTGCTGAAGAACATCACAAAGGTTGCGACAGGGCAACCAGCAA[C/T]
AAAACTATGTTGAAATTGTGATGAACAACATGGCAGTTTATCTTAATTATTCTTCTCTCTCTTATCATTATATATCACCCTTGTTATTAGTCTGTAGTTT

Reverse complement sequence

AAACTACAGACTAATAACAAGGGTGATATATAATGATAAGAGAGAGAAGAATAATTAAGATAAACTGCCATGTTGTTCATCACAATTTCAACATAGTTTT[G/A]
TTGCTGGTTGCCCTGTCGCAACCTTTGTGATGTTCTTCAGCACTGAAGTAGTGGCATACCCTACAGAAAAGAAAGACTAGCAGTCTACCACTTAAAAGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.30%	19.00%	0.95%	27.80%	NA
All Indica	2759	30.40%	31.80%	1.52%	36.32%	NA
All Japonica	1512	90.00%	0.70%	0.07%	9.26%	NA
Aus	269	40.50%	0.00%	0.37%	59.11%	NA
Indica I	595	59.00%	22.90%	0.84%	17.31%	NA
Indica II	465	26.50%	53.80%	2.15%	17.63%	NA
Indica III	913	16.50%	20.80%	0.55%	62.10%	NA
Indica Intermediate	786	27.10%	38.30%	2.80%	31.81%	NA
Temperate Japonica	767	96.00%	1.00%	0.00%	3.00%	NA
Tropical Japonica	504	78.20%	0.40%	0.00%	21.43%	NA
Japonica Intermediate	241	95.90%	0.00%	0.41%	3.73%	NA
VI/Aromatic	96	96.90%	1.00%	0.00%	2.08%	NA
Intermediate	90	77.80%	8.90%	1.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222473124	C -> DEL	N	N	silent_mutation	Average:11.879; most accessible tissue: Callus, score: 53.48	N	N	N	N
vg1222473124	C -> T	LOC_Os12g36680.1	downstream_gene_variant ; 3849.0bp to feature; MODIFIER	silent_mutation	Average:11.879; most accessible tissue: Callus, score: 53.48	N	N	N	N
vg1222473124	C -> T	LOC_Os12g36690.1	downstream_gene_variant ; 3946.0bp to feature; MODIFIER	silent_mutation	Average:11.879; most accessible tissue: Callus, score: 53.48	N	N	N	N
vg1222473124	C -> T	LOC_Os12g36680-LOC_Os12g36690	intergenic_region ; MODIFIER	silent_mutation	Average:11.879; most accessible tissue: Callus, score: 53.48	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222473124	NA	4.41E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	NA	5.06E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	NA	2.14E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	NA	3.99E-06	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	2.54E-06	NA	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	7.35E-06	NA	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	NA	6.34E-06	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	3.57E-06	NA	mr1141_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	1.11E-06	3.34E-10	mr1141_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	NA	1.42E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	7.82E-06	NA	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	NA	1.28E-07	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	NA	9.83E-06	mr1579_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	NA	1.44E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	NA	5.43E-08	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124	NA	5.96E-08	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251