\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222473124:

Variant ID: vg1222473124 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22473124
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTTTTAAGTGGTAGACTGCTAGTCTTTCTTTTCTGTAGGGTATGCCACTACTTCAGTGCTGAAGAACATCACAAAGGTTGCGACAGGGCAACCAGCAA[C/T]
AAAACTATGTTGAAATTGTGATGAACAACATGGCAGTTTATCTTAATTATTCTTCTCTCTCTTATCATTATATATCACCCTTGTTATTAGTCTGTAGTTT

Reverse complement sequence

AAACTACAGACTAATAACAAGGGTGATATATAATGATAAGAGAGAGAAGAATAATTAAGATAAACTGCCATGTTGTTCATCACAATTTCAACATAGTTTT[G/A]
TTGCTGGTTGCCCTGTCGCAACCTTTGTGATGTTCTTCAGCACTGAAGTAGTGGCATACCCTACAGAAAAGAAAGACTAGCAGTCTACCACTTAAAAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 19.00% 0.95% 27.80% NA
All Indica  2759 30.40% 31.80% 1.52% 36.32% NA
All Japonica  1512 90.00% 0.70% 0.07% 9.26% NA
Aus  269 40.50% 0.00% 0.37% 59.11% NA
Indica I  595 59.00% 22.90% 0.84% 17.31% NA
Indica II  465 26.50% 53.80% 2.15% 17.63% NA
Indica III  913 16.50% 20.80% 0.55% 62.10% NA
Indica Intermediate  786 27.10% 38.30% 2.80% 31.81% NA
Temperate Japonica  767 96.00% 1.00% 0.00% 3.00% NA
Tropical Japonica  504 78.20% 0.40% 0.00% 21.43% NA
Japonica Intermediate  241 95.90% 0.00% 0.41% 3.73% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 77.80% 8.90% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222473124 C -> DEL N N silent_mutation Average:11.879; most accessible tissue: Callus, score: 53.48 N N N N
vg1222473124 C -> T LOC_Os12g36680.1 downstream_gene_variant ; 3849.0bp to feature; MODIFIER silent_mutation Average:11.879; most accessible tissue: Callus, score: 53.48 N N N N
vg1222473124 C -> T LOC_Os12g36690.1 downstream_gene_variant ; 3946.0bp to feature; MODIFIER silent_mutation Average:11.879; most accessible tissue: Callus, score: 53.48 N N N N
vg1222473124 C -> T LOC_Os12g36680-LOC_Os12g36690 intergenic_region ; MODIFIER silent_mutation Average:11.879; most accessible tissue: Callus, score: 53.48 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222473124 NA 4.41E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 NA 5.06E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 NA 2.14E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 NA 3.99E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 2.54E-06 NA mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 7.35E-06 NA mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 NA 6.34E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 3.57E-06 NA mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 1.11E-06 3.34E-10 mr1141_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 NA 1.42E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 7.82E-06 NA mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 NA 1.28E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 NA 9.83E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 NA 1.44E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 NA 5.43E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222473124 NA 5.96E-08 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251