\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222465137:

Variant ID: vg1222465137 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22465137
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.16, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AGTCAAAGCAGCCGTGCCAAATTTCAGCCAAACGAATTAGTATTACTGTAGTATTAAGTAGTGTTTAGTGTCAGTGTGTCGCTGTCTAATGTAGGTACGA[T/C]
GACCACTGCTTTGCACTCTCGGTTGATTTTCTGCCCGGCGTGATTAGACTTTGTTTTGATCTCTGAAGCACATGGTTGACCGTCGGTTTGTTGATCCCCT

Reverse complement sequence

AGGGGATCAACAAACCGACGGTCAACCATGTGCTTCAGAGATCAAAACAAAGTCTAATCACGCCGGGCAGAAAATCAACCGAGAGTGCAAAGCAGTGGTC[A/G]
TCGTACCTACATTAGACAGCGACACACTGACACTAAACACTACTTAATACTACAGTAATACTAATTCGTTTGGCTGAAATTTGGCACGGCTGCTTTGACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.30% 18.60% 0.13% 0.00% NA
All Indica  2759 70.20% 29.60% 0.14% 0.00% NA
All Japonica  1512 96.40% 3.40% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 75.80% 24.00% 0.17% 0.00% NA
Indica II  465 52.90% 47.10% 0.00% 0.00% NA
Indica III  913 81.60% 18.40% 0.00% 0.00% NA
Indica Intermediate  786 63.10% 36.50% 0.38% 0.00% NA
Temperate Japonica  767 95.40% 4.30% 0.26% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222465137 T -> C LOC_Os12g36680.1 upstream_gene_variant ; 1225.0bp to feature; MODIFIER silent_mutation Average:49.768; most accessible tissue: Callus, score: 84.995 N N N N
vg1222465137 T -> C LOC_Os12g36670.1 downstream_gene_variant ; 3153.0bp to feature; MODIFIER silent_mutation Average:49.768; most accessible tissue: Callus, score: 84.995 N N N N
vg1222465137 T -> C LOC_Os12g36670-LOC_Os12g36680 intergenic_region ; MODIFIER silent_mutation Average:49.768; most accessible tissue: Callus, score: 84.995 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222465137 8.27E-06 NA mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137 1.55E-08 NA mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137 2.15E-06 NA mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137 NA 5.22E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137 NA 3.26E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137 NA 1.18E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137 2.10E-08 NA mr1389_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137 2.61E-06 NA mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137 NA 6.66E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137 NA 1.06E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137 NA 6.07E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251