\
| Variant ID: vg1222465137 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22465137 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.16, others allele: 0.00, population size: 103. )
AGTCAAAGCAGCCGTGCCAAATTTCAGCCAAACGAATTAGTATTACTGTAGTATTAAGTAGTGTTTAGTGTCAGTGTGTCGCTGTCTAATGTAGGTACGA[T/C]
GACCACTGCTTTGCACTCTCGGTTGATTTTCTGCCCGGCGTGATTAGACTTTGTTTTGATCTCTGAAGCACATGGTTGACCGTCGGTTTGTTGATCCCCT
AGGGGATCAACAAACCGACGGTCAACCATGTGCTTCAGAGATCAAAACAAAGTCTAATCACGCCGGGCAGAAAATCAACCGAGAGTGCAAAGCAGTGGTC[A/G]
TCGTACCTACATTAGACAGCGACACACTGACACTAAACACTACTTAATACTACAGTAATACTAATTCGTTTGGCTGAAATTTGGCACGGCTGCTTTGACT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.30% | 18.60% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 70.20% | 29.60% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 96.40% | 3.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.80% | 24.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 52.90% | 47.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.60% | 18.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 63.10% | 36.50% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 95.40% | 4.30% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222465137 | T -> C | LOC_Os12g36680.1 | upstream_gene_variant ; 1225.0bp to feature; MODIFIER | silent_mutation | Average:49.768; most accessible tissue: Callus, score: 84.995 | N | N | N | N |
| vg1222465137 | T -> C | LOC_Os12g36670.1 | downstream_gene_variant ; 3153.0bp to feature; MODIFIER | silent_mutation | Average:49.768; most accessible tissue: Callus, score: 84.995 | N | N | N | N |
| vg1222465137 | T -> C | LOC_Os12g36670-LOC_Os12g36680 | intergenic_region ; MODIFIER | silent_mutation | Average:49.768; most accessible tissue: Callus, score: 84.995 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222465137 | 8.27E-06 | NA | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222465137 | 1.55E-08 | NA | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222465137 | 2.15E-06 | NA | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222465137 | NA | 5.22E-06 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222465137 | NA | 3.26E-06 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222465137 | NA | 1.18E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222465137 | 2.10E-08 | NA | mr1389_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222465137 | 2.61E-06 | NA | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222465137 | NA | 6.66E-06 | mr1579_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222465137 | NA | 1.06E-06 | mr1756_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222465137 | NA | 6.07E-08 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |