Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1222465137:

Variant ID: vg1222465137 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22465137
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.16, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

AGTCAAAGCAGCCGTGCCAAATTTCAGCCAAACGAATTAGTATTACTGTAGTATTAAGTAGTGTTTAGTGTCAGTGTGTCGCTGTCTAATGTAGGTACGA[T/C]
GACCACTGCTTTGCACTCTCGGTTGATTTTCTGCCCGGCGTGATTAGACTTTGTTTTGATCTCTGAAGCACATGGTTGACCGTCGGTTTGTTGATCCCCT

Reverse complement sequence

AGGGGATCAACAAACCGACGGTCAACCATGTGCTTCAGAGATCAAAACAAAGTCTAATCACGCCGGGCAGAAAATCAACCGAGAGTGCAAAGCAGTGGTC[A/G]
TCGTACCTACATTAGACAGCGACACACTGACACTAAACACTACTTAATACTACAGTAATACTAATTCGTTTGGCTGAAATTTGGCACGGCTGCTTTGACT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.30%	18.60%	0.13%	0.00%	NA
All Indica	2759	70.20%	29.60%	0.14%	0.00%	NA
All Japonica	1512	96.40%	3.40%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	75.80%	24.00%	0.17%	0.00%	NA
Indica II	465	52.90%	47.10%	0.00%	0.00%	NA
Indica III	913	81.60%	18.40%	0.00%	0.00%	NA
Indica Intermediate	786	63.10%	36.50%	0.38%	0.00%	NA
Temperate Japonica	767	95.40%	4.30%	0.26%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	94.20%	5.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222465137	T -> C	LOC_Os12g36680.1	upstream_gene_variant ; 1225.0bp to feature; MODIFIER	silent_mutation	Average:49.768; most accessible tissue: Callus, score: 84.995	N	N	N	N
vg1222465137	T -> C	LOC_Os12g36670.1	downstream_gene_variant ; 3153.0bp to feature; MODIFIER	silent_mutation	Average:49.768; most accessible tissue: Callus, score: 84.995	N	N	N	N
vg1222465137	T -> C	LOC_Os12g36670-LOC_Os12g36680	intergenic_region ; MODIFIER	silent_mutation	Average:49.768; most accessible tissue: Callus, score: 84.995	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222465137	8.27E-06	NA	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137	1.55E-08	NA	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137	2.15E-06	NA	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137	NA	5.22E-06	mr1060_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137	NA	3.26E-06	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137	NA	1.18E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137	2.10E-08	NA	mr1389_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137	2.61E-06	NA	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137	NA	6.66E-06	mr1579_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137	NA	1.06E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222465137	NA	6.07E-08	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251