Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1222456677:

Variant ID: vg1222456677 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22456677
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.26, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTCTTTCCAAGGTGCTTATAAAGATAATATATGTGTGTTCGTTTATAGGGTGAGTTTGTGAATGTTACAAGCGGATATGTTTATGCTGTTTTCATAAG[A/G]
AAAAACCATAAGAGCCTTATCGGTTGCCCATATATGTGTTCCATAGTGACATAAAAGTAAATTTGTAGGTAAAACTTTTGTGTATGATTTTCTAGCGACT

Reverse complement sequence

AGTCGCTAGAAAATCATACACAAAAGTTTTACCTACAAATTTACTTTTATGTCACTATGGAACACATATATGGGCAACCGATAAGGCTCTTATGGTTTTT[T/C]
CTTATGAAAACAGCATAAACATATCCGCTTGTAACATTCACAAACTCACCCTATAAACGAACACACATATATTATCTTTATAAGCACCTTGGAAAGAGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 45.40% 0.17% 0.00% NA
All Indica  2759 37.00% 62.80% 0.22% 0.00% NA
All Japonica  1512 86.40% 13.50% 0.13% 0.00% NA
Aus  269 33.10% 66.90% 0.00% 0.00% NA
Indica I  595 60.20% 39.70% 0.17% 0.00% NA
Indica II  465 7.30% 92.70% 0.00% 0.00% NA
Indica III  913 45.20% 54.50% 0.22% 0.00% NA
Indica Intermediate  786 27.50% 72.10% 0.38% 0.00% NA
Temperate Japonica  767 91.50% 8.50% 0.00% 0.00% NA
Tropical Japonica  504 77.80% 22.00% 0.20% 0.00% NA
Japonica Intermediate  241 88.00% 11.60% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222456677 A -> G LOC_Os12g36670.1 upstream_gene_variant ; 551.0bp to feature; MODIFIER silent_mutation Average:58.374; most accessible tissue: Minghui63 root, score: 89.526 N N N N
vg1222456677 A -> G LOC_Os12g36660-LOC_Os12g36670 intergenic_region ; MODIFIER silent_mutation Average:58.374; most accessible tissue: Minghui63 root, score: 89.526 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1222456677 A G -0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222456677 8.22E-06 NA mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222456677 7.89E-07 1.56E-09 mr1060_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222456677 NA 7.35E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222456677 NA 9.27E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222456677 NA 8.63E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222456677 NA 3.72E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222456677 NA 8.51E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251