\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222445672:

Variant ID: vg1222445672 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 22445672
Reference Allele: AAlternative Allele: G,AT
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.09, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


CGAATCTAGGACCGTATGTGACATATTCTAGTACTATGAATCTGAACATATGTATGTCTAGATTCGTAGTATTAAAATGTGTCACATCCGGTACTAGGTT[A/G,AT]
TTTTTTTATGGGACGGAGGGAGTATATGTTTCCGTGACGAGCTGAGTGAGCTGTAGCAGGATGCACTACTGCTCAAGATCGATATGGATGAAAATTTCAG

Reverse complement sequence

CTGAAATTTTCATCCATATCGATCTTGAGCAGTAGTGCATCCTGCTACAGCTCACTCAGCTCGTCACGGAAACATATACTCCCTCCGTCCCATAAAAAAA[T/C,AT]
AACCTAGTACCGGATGTGACACATTTTAATACTACGAATCTAGACATACATATGTTCAGATTCATAGTACTAGAATATGTCACATACGGTCCTAGATTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.00% 11.00% 2.45% 39.29% AT: 0.28%
All Indica  2759 24.80% 18.20% 2.61% 54.01% AT: 0.43%
All Japonica  1512 84.00% 0.40% 1.32% 14.29% NA
Aus  269 39.80% 0.70% 8.55% 50.93% NA
Indica I  595 58.20% 2.40% 1.68% 37.82% NA
Indica II  465 7.50% 43.00% 1.51% 47.74% AT: 0.22%
Indica III  913 15.60% 15.30% 4.38% 64.62% AT: 0.11%
Indica Intermediate  786 20.40% 18.80% 1.91% 57.63% AT: 1.27%
Temperate Japonica  767 86.30% 0.70% 0.52% 12.52% NA
Tropical Japonica  504 77.60% 0.20% 2.78% 19.44% NA
Japonica Intermediate  241 90.00% 0.00% 0.83% 9.13% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 74.40% 11.10% 1.11% 12.22% AT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222445672 A -> DEL N N silent_mutation Average:23.789; most accessible tissue: Callus, score: 42.977 N N N N
vg1222445672 A -> G LOC_Os12g36660.1 upstream_gene_variant ; 2105.0bp to feature; MODIFIER silent_mutation Average:23.789; most accessible tissue: Callus, score: 42.977 N N N N
vg1222445672 A -> G LOC_Os12g36640-LOC_Os12g36660 intergenic_region ; MODIFIER silent_mutation Average:23.789; most accessible tissue: Callus, score: 42.977 N N N N
vg1222445672 A -> AT LOC_Os12g36660.1 upstream_gene_variant ; 2104.0bp to feature; MODIFIER silent_mutation Average:23.789; most accessible tissue: Callus, score: 42.977 N N N N
vg1222445672 A -> AT LOC_Os12g36640-LOC_Os12g36660 intergenic_region ; MODIFIER silent_mutation Average:23.789; most accessible tissue: Callus, score: 42.977 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222445672 NA 5.29E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 1.25E-12 mr1498 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 9.49E-13 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 1.09E-12 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 3.92E-12 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 4.82E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 6.73E-09 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 2.01E-11 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 1.22E-09 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 1.82E-10 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 9.31E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 5.16E-09 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 1.21E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 8.69E-08 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222445672 NA 1.22E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251