Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222438799:

Variant ID: vg1222438799 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22438799
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGTGGGGTTCAGCTGCAATAGTGTGCGGATAAATGCATGCACCGTTGCTCGATGCAAAAGGATCTAGTGATCTCATATTATCCCAATCCAATAGGGGTG[T/C]
AAAGTTTCAGTGTGTCACATCAGATATTATATATGGTATCGTATGGGGTGTTCGGACACTAATAAAAAAATAATTACATAATCCATCAGTAAACCGCGAG

Reverse complement sequence

CTCGCGGTTTACTGATGGATTATGTAATTATTTTTTTATTAGTGTCCGAACACCCCATACGATACCATATATAATATCTGATGTGACACACTGAAACTTT[A/G]
CACCCCTATTGGATTGGGATAATATGAGATCACTAGATCCTTTTGCATCGAGCAACGGTGCATGCATTTATCCGCACACTATTGCAGCTGAACCCCACGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.80%	13.80%	2.09%	39.27%	NA
All Indica	2759	32.80%	11.20%	2.83%	53.17%	NA
All Japonica	1512	73.90%	10.30%	0.73%	15.01%	NA
Aus	269	8.60%	33.10%	3.35%	55.02%	NA
Indica I	595	24.70%	35.30%	2.35%	37.65%	NA
Indica II	465	50.10%	1.50%	3.01%	45.38%	NA
Indica III	913	27.40%	4.40%	1.53%	66.70%	NA
Indica Intermediate	786	35.10%	6.50%	4.58%	53.82%	NA
Temperate Japonica	767	84.60%	2.20%	0.91%	12.26%	NA
Tropical Japonica	504	66.70%	11.10%	0.60%	21.63%	NA
Japonica Intermediate	241	55.20%	34.40%	0.41%	9.96%	NA
VI/Aromatic	96	11.50%	85.40%	0.00%	3.12%	NA
Intermediate	90	66.70%	20.00%	1.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222438799	T -> C	LOC_Os12g36640-LOC_Os12g36660	intergenic_region ; MODIFIER	silent_mutation	Average:58.611; most accessible tissue: Zhenshan97 panicle, score: 93.657	N	N	N	N
vg1222438799	T -> DEL	N	N	silent_mutation	Average:58.611; most accessible tissue: Zhenshan97 panicle, score: 93.657	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1222438799	T	C	0.11	0.01	0.01	0.04	0.05	0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222438799	NA	6.02E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222438799	NA	1.14E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222438799	NA	1.53E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222438799	NA	4.60E-08	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222438799	NA	1.73E-07	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222438799	NA	9.36E-07	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222438799	NA	5.73E-06	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222438799	2.40E-06	2.93E-07	mr1698_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251