\
| Variant ID: vg1222433459 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22433459 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 53. )
CGTAGTCGACAACAGAGTACTCTTCCTCCTCGAATCTGTGCCCGGAGAGATCAGAGATAGCGCTTTCGTCTCTCCTGACTGTATCCAGAGACACCGTAGG[G/A]
GACTAGCCGTGCCTATCTTTGAAGTTGATATCTGGCGTCTTGCCTTGGCGTATGTTGGCTTGTATGTTGATCTTGTATATTGTGGCTTCTATTGTTCCGT
ACGGAACAATAGAAGCCACAATATACAAGATCAACATACAAGCCAACATACGCCAAGGCAAGACGCCAGATATCAACTTCAAAGATAGGCACGGCTAGTC[C/T]
CCTACGGTGTCTCTGGATACAGTCAGGAGAGACGAAAGCGCTATCTCTGATCTCTCCGGGCACAGATTCGAGGAGGAAGAGTACTCTGTTGTCGACTACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.80% | 4.60% | 1.40% | 39.27% | NA |
| All Indica | 2759 | 37.50% | 7.50% | 1.99% | 52.95% | NA |
| All Japonica | 1512 | 84.50% | 0.30% | 0.40% | 14.81% | NA |
| Aus | 269 | 40.10% | 0.00% | 1.49% | 58.36% | NA |
| Indica I | 595 | 61.30% | 0.30% | 1.01% | 37.31% | NA |
| Indica II | 465 | 24.90% | 28.40% | 1.72% | 44.95% | NA |
| Indica III | 913 | 30.70% | 1.30% | 1.86% | 66.16% | NA |
| Indica Intermediate | 786 | 34.90% | 7.90% | 3.05% | 54.20% | NA |
| Temperate Japonica | 767 | 87.20% | 0.70% | 0.13% | 11.99% | NA |
| Tropical Japonica | 504 | 77.80% | 0.00% | 0.40% | 21.83% | NA |
| Japonica Intermediate | 241 | 89.60% | 0.00% | 1.24% | 9.13% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 83.30% | 3.30% | 1.11% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222433459 | G -> DEL | N | N | silent_mutation | Average:10.014; most accessible tissue: Callus, score: 29.248 | N | N | N | N |
| vg1222433459 | G -> A | LOC_Os12g36630.1 | upstream_gene_variant ; 4361.0bp to feature; MODIFIER | silent_mutation | Average:10.014; most accessible tissue: Callus, score: 29.248 | N | N | N | N |
| vg1222433459 | G -> A | LOC_Os12g36640.1 | upstream_gene_variant ; 1659.0bp to feature; MODIFIER | silent_mutation | Average:10.014; most accessible tissue: Callus, score: 29.248 | N | N | N | N |
| vg1222433459 | G -> A | LOC_Os12g36640.2 | upstream_gene_variant ; 1664.0bp to feature; MODIFIER | silent_mutation | Average:10.014; most accessible tissue: Callus, score: 29.248 | N | N | N | N |
| vg1222433459 | G -> A | LOC_Os12g36640-LOC_Os12g36660 | intergenic_region ; MODIFIER | silent_mutation | Average:10.014; most accessible tissue: Callus, score: 29.248 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222433459 | NA | 5.37E-06 | mr1268 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222433459 | NA | 5.10E-09 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222433459 | NA | 1.60E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222433459 | NA | 7.45E-10 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222433459 | NA | 2.83E-08 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222433459 | NA | 3.73E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222433459 | NA | 2.11E-09 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222433459 | 4.49E-06 | NA | mr1870_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222433459 | 5.68E-06 | NA | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |