Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1222433459:

Variant ID: vg1222433459 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22433459
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

CGTAGTCGACAACAGAGTACTCTTCCTCCTCGAATCTGTGCCCGGAGAGATCAGAGATAGCGCTTTCGTCTCTCCTGACTGTATCCAGAGACACCGTAGG[G/A]
GACTAGCCGTGCCTATCTTTGAAGTTGATATCTGGCGTCTTGCCTTGGCGTATGTTGGCTTGTATGTTGATCTTGTATATTGTGGCTTCTATTGTTCCGT

Reverse complement sequence

ACGGAACAATAGAAGCCACAATATACAAGATCAACATACAAGCCAACATACGCCAAGGCAAGACGCCAGATATCAACTTCAAAGATAGGCACGGCTAGTC[C/T]
CCTACGGTGTCTCTGGATACAGTCAGGAGAGACGAAAGCGCTATCTCTGATCTCTCCGGGCACAGATTCGAGGAGGAAGAGTACTCTGTTGTCGACTACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.80%	4.60%	1.40%	39.27%	NA
All Indica	2759	37.50%	7.50%	1.99%	52.95%	NA
All Japonica	1512	84.50%	0.30%	0.40%	14.81%	NA
Aus	269	40.10%	0.00%	1.49%	58.36%	NA
Indica I	595	61.30%	0.30%	1.01%	37.31%	NA
Indica II	465	24.90%	28.40%	1.72%	44.95%	NA
Indica III	913	30.70%	1.30%	1.86%	66.16%	NA
Indica Intermediate	786	34.90%	7.90%	3.05%	54.20%	NA
Temperate Japonica	767	87.20%	0.70%	0.13%	11.99%	NA
Tropical Japonica	504	77.80%	0.00%	0.40%	21.83%	NA
Japonica Intermediate	241	89.60%	0.00%	1.24%	9.13%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	83.30%	3.30%	1.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222433459	G -> DEL	N	N	silent_mutation	Average:10.014; most accessible tissue: Callus, score: 29.248	N	N	N	N
vg1222433459	G -> A	LOC_Os12g36630.1	upstream_gene_variant ; 4361.0bp to feature; MODIFIER	silent_mutation	Average:10.014; most accessible tissue: Callus, score: 29.248	N	N	N	N
vg1222433459	G -> A	LOC_Os12g36640.1	upstream_gene_variant ; 1659.0bp to feature; MODIFIER	silent_mutation	Average:10.014; most accessible tissue: Callus, score: 29.248	N	N	N	N
vg1222433459	G -> A	LOC_Os12g36640.2	upstream_gene_variant ; 1664.0bp to feature; MODIFIER	silent_mutation	Average:10.014; most accessible tissue: Callus, score: 29.248	N	N	N	N
vg1222433459	G -> A	LOC_Os12g36640-LOC_Os12g36660	intergenic_region ; MODIFIER	silent_mutation	Average:10.014; most accessible tissue: Callus, score: 29.248	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222433459	NA	5.37E-06	mr1268	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459	NA	5.10E-09	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459	NA	1.60E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459	NA	7.45E-10	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459	NA	2.83E-08	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459	NA	3.73E-07	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459	NA	2.11E-09	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459	4.49E-06	NA	mr1870_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459	5.68E-06	NA	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251