\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222433459:

Variant ID: vg1222433459 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22433459
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


CGTAGTCGACAACAGAGTACTCTTCCTCCTCGAATCTGTGCCCGGAGAGATCAGAGATAGCGCTTTCGTCTCTCCTGACTGTATCCAGAGACACCGTAGG[G/A]
GACTAGCCGTGCCTATCTTTGAAGTTGATATCTGGCGTCTTGCCTTGGCGTATGTTGGCTTGTATGTTGATCTTGTATATTGTGGCTTCTATTGTTCCGT

Reverse complement sequence

ACGGAACAATAGAAGCCACAATATACAAGATCAACATACAAGCCAACATACGCCAAGGCAAGACGCCAGATATCAACTTCAAAGATAGGCACGGCTAGTC[C/T]
CCTACGGTGTCTCTGGATACAGTCAGGAGAGACGAAAGCGCTATCTCTGATCTCTCCGGGCACAGATTCGAGGAGGAAGAGTACTCTGTTGTCGACTACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.80% 4.60% 1.40% 39.27% NA
All Indica  2759 37.50% 7.50% 1.99% 52.95% NA
All Japonica  1512 84.50% 0.30% 0.40% 14.81% NA
Aus  269 40.10% 0.00% 1.49% 58.36% NA
Indica I  595 61.30% 0.30% 1.01% 37.31% NA
Indica II  465 24.90% 28.40% 1.72% 44.95% NA
Indica III  913 30.70% 1.30% 1.86% 66.16% NA
Indica Intermediate  786 34.90% 7.90% 3.05% 54.20% NA
Temperate Japonica  767 87.20% 0.70% 0.13% 11.99% NA
Tropical Japonica  504 77.80% 0.00% 0.40% 21.83% NA
Japonica Intermediate  241 89.60% 0.00% 1.24% 9.13% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 83.30% 3.30% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222433459 G -> DEL N N silent_mutation Average:10.014; most accessible tissue: Callus, score: 29.248 N N N N
vg1222433459 G -> A LOC_Os12g36630.1 upstream_gene_variant ; 4361.0bp to feature; MODIFIER silent_mutation Average:10.014; most accessible tissue: Callus, score: 29.248 N N N N
vg1222433459 G -> A LOC_Os12g36640.1 upstream_gene_variant ; 1659.0bp to feature; MODIFIER silent_mutation Average:10.014; most accessible tissue: Callus, score: 29.248 N N N N
vg1222433459 G -> A LOC_Os12g36640.2 upstream_gene_variant ; 1664.0bp to feature; MODIFIER silent_mutation Average:10.014; most accessible tissue: Callus, score: 29.248 N N N N
vg1222433459 G -> A LOC_Os12g36640-LOC_Os12g36660 intergenic_region ; MODIFIER silent_mutation Average:10.014; most accessible tissue: Callus, score: 29.248 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222433459 NA 5.37E-06 mr1268 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459 NA 5.10E-09 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459 NA 1.60E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459 NA 7.45E-10 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459 NA 2.83E-08 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459 NA 3.73E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459 NA 2.11E-09 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459 4.49E-06 NA mr1870_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433459 5.68E-06 NA mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251