Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222433268:

Variant ID: vg1222433268 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22433268
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTGCGAGACTGAGGTAAAAGAGATGGGGACGAGGATTTTTATACAGGTTCGGGCCCCTGAATTGTCAGGTAATAACCCTACATCCTGTTGGCCGAAGCC[A/G]
GTATTGATCTTATTCACCATAATCACACCAGTACAATATTTGGGGTAGCCTATCTAACTGTTGTCGACATGGCGGTCTAAAGGTCTGACTCGTAGTCGAC

Reverse complement sequence

GTCGACTACGAGTCAGACCTTTAGACCGCCATGTCGACAACAGTTAGATAGGCTACCCCAAATATTGTACTGGTGTGATTATGGTGAATAAGATCAATAC[T/C]
GGCTTCGGCCAACAGGATGTAGGGTTATTACCTGACAATTCAGGGGCCCGAACCTGTATAAAAATCCTCGTCCCCATCTCTTTTACCTCAGTCTCGCACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.20%	13.90%	3.51%	40.35%	NA
All Indica	2759	42.20%	1.10%	1.88%	54.84%	NA
All Japonica	1512	37.60%	40.50%	6.55%	15.34%	NA
Aus	269	41.60%	0.40%	3.35%	54.65%	NA
Indica I	595	57.30%	1.00%	2.69%	38.99%	NA
Indica II	465	50.50%	1.70%	0.65%	47.10%	NA
Indica III	913	30.80%	0.50%	0.99%	67.69%	NA
Indica Intermediate	786	39.20%	1.30%	3.05%	56.49%	NA
Temperate Japonica	767	12.90%	65.10%	9.52%	12.52%	NA
Tropical Japonica	504	65.50%	9.10%	3.37%	22.02%	NA
Japonica Intermediate	241	58.10%	27.80%	3.73%	10.37%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	61.10%	18.90%	6.67%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222433268	A -> DEL	N	N	silent_mutation	Average:22.977; most accessible tissue: Callus, score: 48.585	N	N	N	N
vg1222433268	A -> G	LOC_Os12g36630.1	upstream_gene_variant ; 4170.0bp to feature; MODIFIER	silent_mutation	Average:22.977; most accessible tissue: Callus, score: 48.585	N	N	N	N
vg1222433268	A -> G	LOC_Os12g36640.1	upstream_gene_variant ; 1468.0bp to feature; MODIFIER	silent_mutation	Average:22.977; most accessible tissue: Callus, score: 48.585	N	N	N	N
vg1222433268	A -> G	LOC_Os12g36640.2	upstream_gene_variant ; 1473.0bp to feature; MODIFIER	silent_mutation	Average:22.977; most accessible tissue: Callus, score: 48.585	N	N	N	N
vg1222433268	A -> G	LOC_Os12g36640-LOC_Os12g36660	intergenic_region ; MODIFIER	silent_mutation	Average:22.977; most accessible tissue: Callus, score: 48.585	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222433268	NA	1.57E-07	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	8.18E-06	mr1075	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	6.10E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	1.03E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	1.73E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	1.33E-07	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	2.46E-08	mr1441	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	1.17E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	5.07E-06	mr1685	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	9.22E-06	mr1712	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	5.05E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	6.69E-07	6.69E-07	mr1861	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	4.83E-06	mr1910	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	8.52E-06	mr1946	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	9.62E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	2.38E-09	mr1977	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	8.53E-06	mr1982	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268	NA	9.47E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251