\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222433268:

Variant ID: vg1222433268 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22433268
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTGCGAGACTGAGGTAAAAGAGATGGGGACGAGGATTTTTATACAGGTTCGGGCCCCTGAATTGTCAGGTAATAACCCTACATCCTGTTGGCCGAAGCC[A/G]
GTATTGATCTTATTCACCATAATCACACCAGTACAATATTTGGGGTAGCCTATCTAACTGTTGTCGACATGGCGGTCTAAAGGTCTGACTCGTAGTCGAC

Reverse complement sequence

GTCGACTACGAGTCAGACCTTTAGACCGCCATGTCGACAACAGTTAGATAGGCTACCCCAAATATTGTACTGGTGTGATTATGGTGAATAAGATCAATAC[T/C]
GGCTTCGGCCAACAGGATGTAGGGTTATTACCTGACAATTCAGGGGCCCGAACCTGTATAAAAATCCTCGTCCCCATCTCTTTTACCTCAGTCTCGCACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.20% 13.90% 3.51% 40.35% NA
All Indica  2759 42.20% 1.10% 1.88% 54.84% NA
All Japonica  1512 37.60% 40.50% 6.55% 15.34% NA
Aus  269 41.60% 0.40% 3.35% 54.65% NA
Indica I  595 57.30% 1.00% 2.69% 38.99% NA
Indica II  465 50.50% 1.70% 0.65% 47.10% NA
Indica III  913 30.80% 0.50% 0.99% 67.69% NA
Indica Intermediate  786 39.20% 1.30% 3.05% 56.49% NA
Temperate Japonica  767 12.90% 65.10% 9.52% 12.52% NA
Tropical Japonica  504 65.50% 9.10% 3.37% 22.02% NA
Japonica Intermediate  241 58.10% 27.80% 3.73% 10.37% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 61.10% 18.90% 6.67% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222433268 A -> DEL N N silent_mutation Average:22.977; most accessible tissue: Callus, score: 48.585 N N N N
vg1222433268 A -> G LOC_Os12g36630.1 upstream_gene_variant ; 4170.0bp to feature; MODIFIER silent_mutation Average:22.977; most accessible tissue: Callus, score: 48.585 N N N N
vg1222433268 A -> G LOC_Os12g36640.1 upstream_gene_variant ; 1468.0bp to feature; MODIFIER silent_mutation Average:22.977; most accessible tissue: Callus, score: 48.585 N N N N
vg1222433268 A -> G LOC_Os12g36640.2 upstream_gene_variant ; 1473.0bp to feature; MODIFIER silent_mutation Average:22.977; most accessible tissue: Callus, score: 48.585 N N N N
vg1222433268 A -> G LOC_Os12g36640-LOC_Os12g36660 intergenic_region ; MODIFIER silent_mutation Average:22.977; most accessible tissue: Callus, score: 48.585 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222433268 NA 1.57E-07 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 8.18E-06 mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 6.10E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 1.03E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 1.73E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 1.33E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 2.46E-08 mr1441 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 1.17E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 5.07E-06 mr1685 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 9.22E-06 mr1712 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 5.05E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 6.69E-07 6.69E-07 mr1861 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 4.83E-06 mr1910 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 8.52E-06 mr1946 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 9.62E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 2.38E-09 mr1977 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 8.53E-06 mr1982 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433268 NA 9.47E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251