Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222419954:

Variant ID: vg1222419954 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22419954
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, G: 0.29, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTGGCGTTGATTTGATATGATTTGACAATGTGATGCTACCGTAAATATTTGCTAATGACAGATTAATTAGGCTTAATAGATTCGTCTCGCAGTTTATA[T/G]
GCGGAATTTATAATTTGTTTTGTTATTAGTCTACATTTAATACTTTAAATATGTTTCTGTATACTTAAAAAAGATTTGGCACACGAACTAAACACAGCCT

Reverse complement sequence

AGGCTGTGTTTAGTTCGTGTGCCAAATCTTTTTTAAGTATACAGAAACATATTTAAAGTATTAAATGTAGACTAATAACAAAACAAATTATAAATTCCGC[A/C]
TATAAACTGCGAGACGAATCTATTAAGCCTAATTAATCTGTCATTAGCAAATATTTACGGTAGCATCACATTGTCAAATCATATCAAATCAACGCCAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.40%	25.20%	0.51%	42.89%	NA
All Indica	2759	35.70%	4.10%	0.72%	59.44%	NA
All Japonica	1512	19.20%	67.70%	0.13%	12.90%	NA
Aus	269	34.90%	1.10%	0.74%	63.20%	NA
Indica I	595	38.00%	4.50%	0.67%	56.81%	NA
Indica II	465	17.20%	5.40%	0.22%	77.20%	NA
Indica III	913	43.20%	2.00%	1.10%	53.78%	NA
Indica Intermediate	786	36.40%	5.50%	0.64%	57.51%	NA
Temperate Japonica	767	14.20%	77.20%	0.00%	8.60%	NA
Tropical Japonica	504	13.30%	65.70%	0.20%	20.83%	NA
Japonica Intermediate	241	47.70%	41.90%	0.41%	9.96%	NA
VI/Aromatic	96	87.50%	8.30%	0.00%	4.17%	NA
Intermediate	90	34.40%	45.60%	0.00%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222419954	T -> DEL	N	N	silent_mutation	Average:10.616; most accessible tissue: Callus, score: 63.722	N	N	N	N
vg1222419954	T -> G	LOC_Os12g36600.1	downstream_gene_variant ; 4338.0bp to feature; MODIFIER	silent_mutation	Average:10.616; most accessible tissue: Callus, score: 63.722	N	N	N	N
vg1222419954	T -> G	LOC_Os12g36610.1	downstream_gene_variant ; 689.0bp to feature; MODIFIER	silent_mutation	Average:10.616; most accessible tissue: Callus, score: 63.722	N	N	N	N
vg1222419954	T -> G	LOC_Os12g36620.1	intron_variant ; MODIFIER	silent_mutation	Average:10.616; most accessible tissue: Callus, score: 63.722	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222419954	NA	4.80E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	1.51E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	9.26E-06	NA	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	1.14E-06	mr1020	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	1.63E-06	NA	mr1021	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	6.20E-07	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	6.78E-07	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	1.21E-08	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	5.18E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	3.67E-06	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	4.09E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	8.95E-06	mr1127	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	4.43E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	2.35E-07	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	3.98E-06	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	1.77E-06	NA	mr1477	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	6.57E-08	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	6.36E-08	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	2.72E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	5.30E-06	mr1590	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	2.69E-06	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	1.24E-06	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	6.34E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	1.08E-06	mr1738	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	7.37E-07	2.94E-07	mr1755	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	3.73E-06	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	7.28E-06	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	1.06E-06	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	1.83E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	4.55E-07	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	7.88E-08	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	4.49E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	3.19E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	5.72E-06	mr1494_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	1.66E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	1.12E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	1.97E-07	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	5.64E-06	mr1814_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	NA	5.70E-06	mr1894_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419954	4.34E-06	4.35E-06	mr1983_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251