\
| Variant ID: vg1222410674 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22410674 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, C: 0.18, others allele: 0.00, population size: 68. )
GGCCTTTGAGCCCATGTAGCCCTTTGGTTCCATGGCGAAGGTGCTCCAAGCGGTCGCGAATCTTTCATGCTTCGCCCGGACGTTTCACCCAAAGTGAATG[T/C]
TTTGGTCCTCGCTTGGTTGCTTCGCCCTGGTCGCAGTGGTTTCGGCAGCCTCGATCGAAGGCCCTCGTGGCATGCCTCCAACAAGCTCACCCATTCTCCG
CGGAGAATGGGTGAGCTTGTTGGAGGCATGCCACGAGGGCCTTCGATCGAGGCTGCCGAAACCACTGCGACCAGGGCGAAGCAACCAAGCGAGGACCAAA[A/G]
CATTCACTTTGGGTGAAACGTCCGGGCGAAGCATGAAAGATTCGCGACCGCTTGGAGCACCTTCGCCATGGAACCAAAGGGCTACATGGGCTCAAAGGCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.20% | 17.90% | 0.61% | 43.36% | NA |
| All Indica | 2759 | 9.60% | 29.40% | 0.72% | 60.35% | NA |
| All Japonica | 1512 | 86.20% | 0.70% | 0.33% | 12.83% | NA |
| Aus | 269 | 32.30% | 4.50% | 0.74% | 62.45% | NA |
| Indica I | 595 | 10.80% | 29.70% | 0.84% | 58.66% | NA |
| Indica II | 465 | 4.50% | 17.20% | 1.29% | 76.99% | NA |
| Indica III | 913 | 9.90% | 34.90% | 0.33% | 54.87% | NA |
| Indica Intermediate | 786 | 11.30% | 29.80% | 0.76% | 58.14% | NA |
| Temperate Japonica | 767 | 91.30% | 0.10% | 0.26% | 8.34% | NA |
| Tropical Japonica | 504 | 77.20% | 1.20% | 0.60% | 21.03% | NA |
| Japonica Intermediate | 241 | 88.80% | 1.20% | 0.00% | 9.96% | NA |
| VI/Aromatic | 96 | 92.70% | 2.10% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 66.70% | 12.20% | 2.22% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222410674 | T -> C | LOC_Os12g36600.1 | upstream_gene_variant ; 3789.0bp to feature; MODIFIER | silent_mutation | Average:17.669; most accessible tissue: Callus, score: 43.408 | N | N | N | N |
| vg1222410674 | T -> C | LOC_Os12g36590.1 | intron_variant ; MODIFIER | silent_mutation | Average:17.669; most accessible tissue: Callus, score: 43.408 | N | N | N | N |
| vg1222410674 | T -> DEL | N | N | silent_mutation | Average:17.669; most accessible tissue: Callus, score: 43.408 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222410674 | NA | 1.76E-06 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222410674 | NA | 9.71E-06 | mr1021 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222410674 | NA | 3.90E-07 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222410674 | NA | 5.21E-06 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222410674 | NA | 6.02E-06 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222410674 | NA | 5.92E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222410674 | NA | 4.41E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222410674 | NA | 1.36E-06 | mr1660 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222410674 | 4.45E-06 | 4.45E-06 | mr1738 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |