\
| Variant ID: vg1222407333 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22407333 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.86, T: 0.14, others allele: 0.00, population size: 63. )
CGATGATGAGATTACAAGTGCCGGATTCAGTTTTCCTTGGAGGGGGATTACAAGTGCTGGATTCAGCTTTCCTAGGAGGCTTAAGCACATAGTCATAAGG[A/T]
ACAGTTATCCCTCTATCAGCTGCCTGAAAACATTGAAGCTTATCACCGAGATATTCATGCTAATGGTTCGACATGGAAGCGGTTACACCAAAGAAGAGAC
GTCTCTTCTTTGGTGTAACCGCTTCCATGTCGAACCATTAGCATGAATATCTCGGTGATAAGCTTCAATGTTTTCAGGCAGCTGATAGAGGGATAACTGT[T/A]
CCTTATGACTATGTGCTTAAGCCTCCTAGGAAAGCTGAATCCAGCACTTGTAATCCCCCTCCAAGGAAAACTGAATCCGGCACTTGTAATCTCATCATCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.60% | 17.70% | 0.78% | 42.89% | NA |
| All Indica | 2759 | 10.20% | 29.10% | 0.98% | 59.73% | NA |
| All Japonica | 1512 | 86.30% | 0.70% | 0.26% | 12.76% | NA |
| Aus | 269 | 32.70% | 4.50% | 1.86% | 60.97% | NA |
| Indica I | 595 | 10.90% | 29.60% | 0.84% | 58.66% | NA |
| Indica II | 465 | 4.90% | 17.00% | 0.86% | 77.20% | NA |
| Indica III | 913 | 10.60% | 34.70% | 1.31% | 53.34% | NA |
| Indica Intermediate | 786 | 12.30% | 29.30% | 0.76% | 57.63% | NA |
| Temperate Japonica | 767 | 91.50% | 0.10% | 0.13% | 8.21% | NA |
| Tropical Japonica | 504 | 77.20% | 1.20% | 0.40% | 21.23% | NA |
| Japonica Intermediate | 241 | 88.80% | 1.20% | 0.41% | 9.54% | NA |
| VI/Aromatic | 96 | 92.70% | 2.10% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 67.80% | 12.20% | 1.11% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222407333 | A -> DEL | LOC_Os12g36590.1 | N | frameshift_variant | Average:11.756; most accessible tissue: Callus, score: 65.404 | N | N | N | N |
| vg1222407333 | A -> T | LOC_Os12g36590.1 | missense_variant ; p.Asn673Tyr; MODERATE | nonsynonymous_codon | Average:11.756; most accessible tissue: Callus, score: 65.404 | unknown | unknown | TOLERATED | 0.65 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222407333 | NA | 2.64E-06 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 5.24E-07 | mr1021 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 5.58E-07 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 1.12E-13 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 4.16E-07 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 4.05E-06 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 8.48E-07 | mr1291 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 9.16E-06 | mr1471 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 2.85E-06 | mr1477 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 1.42E-06 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 4.92E-06 | mr1553 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 4.19E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 3.96E-06 | mr1660 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | 5.33E-06 | NA | mr1738 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | 5.23E-06 | 5.22E-06 | mr1738 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 9.03E-06 | mr1815 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | 2.89E-06 | 2.88E-06 | mr1848_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222407333 | NA | 1.30E-06 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |