Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222403923:

Variant ID: vg1222403923 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22403923
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.16, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

GTCTATAAGTCCCTTCCAAGCTATCCAAAAACCAGCCCAATCAGACACCGTTTGACCCCTCAAACTGACATTCTACCACAGACTGTACACGCTGAAACTG[C/T]
GGTTACTCGAGCTGAAGAAACCATACCCAAATCTGATGCTCTACTCAACCAATTCCCACCAAAACTGGCCAGATTGAAGTTCACCAAGTGAGAAATAAAC

Reverse complement sequence

GTTTATTTCTCACTTGGTGAACTTCAATCTGGCCAGTTTTGGTGGGAATTGGTTGAGTAGAGCATCAGATTTGGGTATGGTTTCTTCAGCTCGAGTAACC[G/A]
CAGTTTCAGCGTGTACAGTCTGTGGTAGAATGTCAGTTTGAGGGGTCAAACGGTGTCTGATTGGGCTGGTTTTTGGATAGCTTGGAAGGGACTTATAGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.20%	18.30%	0.85%	42.62%	NA
All Indica	2759	9.30%	30.20%	0.91%	59.62%	NA
All Japonica	1512	86.50%	0.70%	0.60%	12.24%	NA
Aus	269	33.50%	4.50%	1.86%	60.22%	NA
Indica I	595	11.10%	29.90%	0.17%	58.82%	NA
Indica II	465	5.20%	17.40%	0.86%	76.56%	NA
Indica III	913	8.90%	36.70%	1.10%	53.34%	NA
Indica Intermediate	786	10.90%	30.30%	1.27%	57.51%	NA
Temperate Japonica	767	91.50%	0.10%	0.13%	8.21%	NA
Tropical Japonica	504	77.60%	1.20%	1.59%	19.64%	NA
Japonica Intermediate	241	89.20%	1.20%	0.00%	9.54%	NA
VI/Aromatic	96	92.70%	2.10%	0.00%	5.21%	NA
Intermediate	90	67.80%	12.20%	1.11%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222403923	C -> DEL	LOC_Os12g36590.1	N	frameshift_variant	Average:9.477; most accessible tissue: Callus, score: 42.955	N	N	N	N
vg1222403923	C -> T	LOC_Os12g36590.1	missense_variant ; p.Ala36Val; MODERATE	nonsynonymous_codon ; A36V	Average:9.477; most accessible tissue: Callus, score: 42.955	unknown	unknown	TOLERATED	0.66

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222403923	NA	1.15E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	4.14E-07	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	2.98E-07	mr1020	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	9.21E-06	8.46E-09	mr1021	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	4.63E-08	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	1.83E-14	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	2.08E-08	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	7.31E-07	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	6.91E-08	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	2.71E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	8.22E-07	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	6.55E-08	mr1291	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	8.82E-08	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	1.17E-13	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	1.40E-07	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	7.25E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	2.87E-06	mr1553	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	1.95E-06	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	9.55E-06	NA	mr1738	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	4.03E-06	4.02E-06	mr1738	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	5.76E-06	mr1971	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	3.31E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	8.43E-06	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	8.33E-06	mr1820_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	6.30E-06	mr1876_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222403923	NA	2.89E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251