\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222400637:

Variant ID: vg1222400637 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22400637
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.11, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAACAAGTTTTTACTGGCGACTAAAATAGGTTTTTGCTGGTGGCCCGTGGCGCCGCTAGTGACCTAAGGCAAGTGAAAAAAATAAATTTTCACTGACA[A/G]
TGTTCGGCTGCCAGTGAGAATTGACTTTGGGAGGTGGCCAAGTTAATAAGGCTGCTAGTGAAAACAACGATTTTCGTTGACGGCAGTTAAAGAGACTTAC

Reverse complement sequence

GTAAGTCTCTTTAACTGCCGTCAACGAAAATCGTTGTTTTCACTAGCAGCCTTATTAACTTGGCCACCTCCCAAAGTCAATTCTCACTGGCAGCCGAACA[T/C]
TGTCAGTGAAAATTTATTTTTTTCACTTGCCTTAGGTCACTAGCGGCGCCACGGGCCACCAGCAAAAACCTATTTTAGTCGCCAGTAAAAACTTGTTTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.10% 23.60% 0.49% 43.88% NA
All Indica  2759 35.70% 2.70% 0.54% 61.04% NA
All Japonica  1512 21.20% 65.30% 0.53% 12.96% NA
Aus  269 35.70% 0.40% 0.00% 63.94% NA
Indica I  595 38.20% 1.80% 0.34% 59.66% NA
Indica II  465 17.20% 4.10% 1.08% 77.63% NA
Indica III  913 42.50% 2.20% 0.22% 55.09% NA
Indica Intermediate  786 36.90% 3.20% 0.76% 59.16% NA
Temperate Japonica  767 18.50% 72.20% 0.91% 8.34% NA
Tropical Japonica  504 12.90% 65.70% 0.00% 21.43% NA
Japonica Intermediate  241 47.30% 42.30% 0.41% 9.96% NA
VI/Aromatic  96 86.50% 8.30% 0.00% 5.21% NA
Intermediate  90 34.40% 46.70% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222400637 A -> DEL N N silent_mutation Average:10.501; most accessible tissue: Callus, score: 48.477 N N N N
vg1222400637 A -> G LOC_Os12g36590.1 upstream_gene_variant ; 3180.0bp to feature; MODIFIER silent_mutation Average:10.501; most accessible tissue: Callus, score: 48.477 N N N N
vg1222400637 A -> G LOC_Os12g36580.1 downstream_gene_variant ; 3254.0bp to feature; MODIFIER silent_mutation Average:10.501; most accessible tissue: Callus, score: 48.477 N N N N
vg1222400637 A -> G LOC_Os12g36580-LOC_Os12g36590 intergenic_region ; MODIFIER silent_mutation Average:10.501; most accessible tissue: Callus, score: 48.477 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222400637 NA 3.23E-07 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 2.26E-07 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 2.57E-06 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 3.71E-06 NA mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 1.33E-07 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 5.22E-08 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 4.13E-08 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 3.15E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 2.36E-07 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 1.96E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 6.73E-07 mr1127 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 5.31E-07 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 4.23E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 4.65E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 4.46E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 1.67E-08 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 6.96E-08 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 3.44E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 3.93E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 3.97E-06 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 4.14E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 4.97E-06 6.94E-07 mr1738 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 3.29E-06 1.51E-06 mr1755 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 2.16E-06 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 9.29E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 9.97E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637 NA 2.17E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251