Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222400637:

Variant ID: vg1222400637 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22400637
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.11, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAACAAGTTTTTACTGGCGACTAAAATAGGTTTTTGCTGGTGGCCCGTGGCGCCGCTAGTGACCTAAGGCAAGTGAAAAAAATAAATTTTCACTGACA[A/G]
TGTTCGGCTGCCAGTGAGAATTGACTTTGGGAGGTGGCCAAGTTAATAAGGCTGCTAGTGAAAACAACGATTTTCGTTGACGGCAGTTAAAGAGACTTAC

Reverse complement sequence

GTAAGTCTCTTTAACTGCCGTCAACGAAAATCGTTGTTTTCACTAGCAGCCTTATTAACTTGGCCACCTCCCAAAGTCAATTCTCACTGGCAGCCGAACA[T/C]
TGTCAGTGAAAATTTATTTTTTTCACTTGCCTTAGGTCACTAGCGGCGCCACGGGCCACCAGCAAAAACCTATTTTAGTCGCCAGTAAAAACTTGTTTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.10%	23.60%	0.49%	43.88%	NA
All Indica	2759	35.70%	2.70%	0.54%	61.04%	NA
All Japonica	1512	21.20%	65.30%	0.53%	12.96%	NA
Aus	269	35.70%	0.40%	0.00%	63.94%	NA
Indica I	595	38.20%	1.80%	0.34%	59.66%	NA
Indica II	465	17.20%	4.10%	1.08%	77.63%	NA
Indica III	913	42.50%	2.20%	0.22%	55.09%	NA
Indica Intermediate	786	36.90%	3.20%	0.76%	59.16%	NA
Temperate Japonica	767	18.50%	72.20%	0.91%	8.34%	NA
Tropical Japonica	504	12.90%	65.70%	0.00%	21.43%	NA
Japonica Intermediate	241	47.30%	42.30%	0.41%	9.96%	NA
VI/Aromatic	96	86.50%	8.30%	0.00%	5.21%	NA
Intermediate	90	34.40%	46.70%	0.00%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222400637	A -> DEL	N	N	silent_mutation	Average:10.501; most accessible tissue: Callus, score: 48.477	N	N	N	N
vg1222400637	A -> G	LOC_Os12g36590.1	upstream_gene_variant ; 3180.0bp to feature; MODIFIER	silent_mutation	Average:10.501; most accessible tissue: Callus, score: 48.477	N	N	N	N
vg1222400637	A -> G	LOC_Os12g36580.1	downstream_gene_variant ; 3254.0bp to feature; MODIFIER	silent_mutation	Average:10.501; most accessible tissue: Callus, score: 48.477	N	N	N	N
vg1222400637	A -> G	LOC_Os12g36580-LOC_Os12g36590	intergenic_region ; MODIFIER	silent_mutation	Average:10.501; most accessible tissue: Callus, score: 48.477	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222400637	NA	3.23E-07	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	2.26E-07	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	2.57E-06	mr1020	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	3.71E-06	NA	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	1.33E-07	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	5.22E-08	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	4.13E-08	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	3.15E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	2.36E-07	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	1.96E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	6.73E-07	mr1127	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	5.31E-07	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	4.23E-06	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	4.65E-06	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	4.46E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	1.67E-08	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	6.96E-08	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	3.44E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	3.93E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	3.97E-06	mr1590	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	4.14E-06	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	4.97E-06	6.94E-07	mr1738	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	3.29E-06	1.51E-06	mr1755	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	2.16E-06	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	9.29E-06	mr1971	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	9.97E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222400637	NA	2.17E-06	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251