\
| Variant ID: vg1222399385 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 22399385 |
| Reference Allele: C | Alternative Allele: T,CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG,CCTCTAATTAATCTAGTTTAACTGGCGACGGGTTTGGG |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATCAATTTTCATCATGCAATAATTGTAAATCCAGTGATAGTTTTTAAAGAAATGATTTGAAATGTTTTTATGAAATATAGAAGAAATACAATAAATTCA[C/T,CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG,CCTCTAATTAATCTAGTTTAACTGGCGACGGGTTTGGG]
ATGCAATAATTTTACCGTCCTTGAGAAGGTACCATGAGGTACCACTTATGCTACCTTCCAAATGACTGTAAAATTGCCCAATTCTAGCAACAGGAGCAAA
TTTGCTCCTGTTGCTAGAATTGGGCAATTTTACAGTCATTTGGAAGGTAGCATAAGTGGTACCTCATGGTACCTTCTCAAGGACGGTAAAATTATTGCAT[G/A,CCCAAACCCCTGTCGCCAGTTAAACTAGATTAATTAGAGG,CCCAAACCCGTCGCCAGTTAAACTAGATTAATTAGAGG]
TGAATTTATTGTATTTCTTCTATATTTCATAAAAACATTTCAAATCATTTCTTTAAAAACTATCACTGGATTTACAATTATTGCATGATGAAAATTGATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.10% | 10.10% | 18.73% | 9.56% | CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG: 5.27%; CCTCTAATTAATCTAGTTTAACTGGCGACGGGTTTGGG: 0.23% |
| All Indica | 2759 | 39.00% | 14.50% | 24.61% | 14.35% | CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG: 7.39%; CCTCTAATTAATCTAGTTTAACTGGCGACGGGTTTGGG: 0.11% |
| All Japonica | 1512 | 86.80% | 2.50% | 7.54% | 1.98% | CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG: 1.19% |
| Aus | 269 | 36.80% | 13.80% | 29.00% | 8.92% | CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG: 8.55%; CCTCTAATTAATCTAGTTTAACTGGCGACGGGTTTGGG: 2.97% |
| Indica I | 595 | 39.80% | 13.10% | 32.94% | 11.60% | CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG: 2.52% |
| Indica II | 465 | 22.40% | 14.40% | 27.74% | 32.04% | CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG: 3.44% |
| Indica III | 913 | 44.90% | 16.40% | 18.51% | 7.67% | CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG: 12.27%; CCTCTAATTAATCTAGTTTAACTGGCGACGGGTTTGGG: 0.22% |
| Indica Intermediate | 786 | 41.30% | 13.50% | 23.54% | 13.74% | CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG: 7.76%; CCTCTAATTAATCTAGTTTAACTGGCGACGGGTTTGGG: 0.13% |
| Temperate Japonica | 767 | 91.50% | 1.20% | 5.74% | 1.30% | CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG: 0.26% |
| Tropical Japonica | 504 | 78.60% | 5.20% | 10.12% | 3.37% | CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG: 2.78% |
| Japonica Intermediate | 241 | 88.80% | 1.20% | 7.88% | 1.24% | CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG: 0.83% |
| VI/Aromatic | 96 | 94.80% | 0.00% | 3.12% | 0.00% | CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG: 2.08% |
| Intermediate | 90 | 80.00% | 3.30% | 12.22% | 2.22% | CCTCTAATTAATCTAGTTTAACTGGCGACAGGGGTTTGGG: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222399385 | C -> CCTCTAATTAATCTAGTTTAACTGGCGACA GGGGTTTGGG | LOC_Os12g36590.1 | upstream_gene_variant ; 4431.0bp to feature; MODIFIER | silent_mutation | Average:18.568; most accessible tissue: Callus, score: 34.927 | N | N | N | N |
| vg1222399385 | C -> CCTCTAATTAATCTAGTTTAACTGGCGACA GGGGTTTGGG | LOC_Os12g36580.1 | downstream_gene_variant ; 2003.0bp to feature; MODIFIER | silent_mutation | Average:18.568; most accessible tissue: Callus, score: 34.927 | N | N | N | N |
| vg1222399385 | C -> CCTCTAATTAATCTAGTTTAACTGGCGACA GGGGTTTGGG | LOC_Os12g36580-LOC_Os12g36590 | intergenic_region ; MODIFIER | silent_mutation | Average:18.568; most accessible tissue: Callus, score: 34.927 | N | N | N | N |
| vg1222399385 | C -> CCTCTAATTAATCTAGTTTAACTGGCGACG GGTTTGGG | LOC_Os12g36590.1 | upstream_gene_variant ; 4431.0bp to feature; MODIFIER | silent_mutation | Average:18.568; most accessible tissue: Callus, score: 34.927 | N | N | N | N |
| vg1222399385 | C -> CCTCTAATTAATCTAGTTTAACTGGCGACG GGTTTGGG | LOC_Os12g36580.1 | downstream_gene_variant ; 2003.0bp to feature; MODIFIER | silent_mutation | Average:18.568; most accessible tissue: Callus, score: 34.927 | N | N | N | N |
| vg1222399385 | C -> CCTCTAATTAATCTAGTTTAACTGGCGACG GGTTTGGG | LOC_Os12g36580-LOC_Os12g36590 | intergenic_region ; MODIFIER | silent_mutation | Average:18.568; most accessible tissue: Callus, score: 34.927 | N | N | N | N |
| vg1222399385 | C -> DEL | N | N | silent_mutation | Average:18.568; most accessible tissue: Callus, score: 34.927 | N | N | N | N |
| vg1222399385 | C -> T | LOC_Os12g36590.1 | upstream_gene_variant ; 4432.0bp to feature; MODIFIER | silent_mutation | Average:18.568; most accessible tissue: Callus, score: 34.927 | N | N | N | N |
| vg1222399385 | C -> T | LOC_Os12g36580.1 | downstream_gene_variant ; 2002.0bp to feature; MODIFIER | silent_mutation | Average:18.568; most accessible tissue: Callus, score: 34.927 | N | N | N | N |
| vg1222399385 | C -> T | LOC_Os12g36580-LOC_Os12g36590 | intergenic_region ; MODIFIER | silent_mutation | Average:18.568; most accessible tissue: Callus, score: 34.927 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222399385 | NA | 2.59E-08 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 1.72E-07 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 5.59E-08 | mr1021 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 3.14E-09 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 3.17E-07 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 4.54E-06 | mr1034 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 4.45E-08 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 6.42E-06 | mr1127 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | 5.24E-06 | 5.26E-06 | mr1160 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 2.57E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 9.88E-07 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 3.39E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 1.52E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 3.78E-06 | mr1291 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 7.41E-06 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 3.57E-06 | mr1344 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 9.71E-06 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 9.28E-09 | mr1477 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 4.44E-07 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 9.86E-07 | mr1513 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 2.55E-07 | mr1590 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 2.39E-06 | mr1660 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 9.88E-06 | mr1783 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 6.42E-06 | mr1964 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 1.82E-06 | mr1965 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 2.08E-06 | mr1981 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 3.25E-06 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 8.07E-07 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 6.73E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 2.34E-07 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 5.72E-06 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 2.18E-06 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 2.73E-08 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 2.32E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | 7.18E-06 | 2.94E-08 | mr1706_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222399385 | NA | 3.29E-06 | mr1706_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |