\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222399044:

Variant ID: vg1222399044 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22399044
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, G: 0.17, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCTGAAACACTTAACTGCAGATATGGGTTTAAGACAATTGCCAGATGGCAGAGCCCCTCCGTGGAGGCTGTATCAGTCATCACCTGGTATAGATGAAG[T/G]
TACATAACTCGTCACAATCGTTGCATAATTCTGATTTCTGAAGCTACATAATGCTATTATCCTCTGTAAAATAAATGAAAATATATTCTGGGTGCCAATA

Reverse complement sequence

TATTGGCACCCAGAATATATTTTCATTTATTTTACAGAGGATAATAGCATTATGTAGCTTCAGAAATCAGAATTATGCAACGATTGTGACGAGTTATGTA[A/C]
CTTCATCTATACCAGGTGATGACTGATACAGCCTCCACGGAGGGGCTCTGCCATCTGGCAATTGTCTTAAACCCATATCTGCAGTTAAGTGTTTCAGGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 44.60% 0.40% 0.59% NA
All Indica  2759 37.00% 61.90% 0.47% 0.62% NA
All Japonica  1512 86.40% 13.40% 0.20% 0.00% NA
Aus  269 31.20% 64.70% 0.74% 3.35% NA
Indica I  595 39.30% 60.20% 0.50% 0.00% NA
Indica II  465 20.40% 78.90% 0.43% 0.22% NA
Indica III  913 42.30% 56.00% 0.55% 1.20% NA
Indica Intermediate  786 39.10% 59.90% 0.38% 0.64% NA
Temperate Japonica  767 91.10% 8.60% 0.26% 0.00% NA
Tropical Japonica  504 78.00% 21.80% 0.20% 0.00% NA
Japonica Intermediate  241 89.20% 10.80% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 5.20% 1.04% 2.08% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222399044 T -> DEL N N silent_mutation Average:41.354; most accessible tissue: Callus, score: 87.829 N N N N
vg1222399044 T -> G LOC_Os12g36590.1 upstream_gene_variant ; 4773.0bp to feature; MODIFIER silent_mutation Average:41.354; most accessible tissue: Callus, score: 87.829 N N N N
vg1222399044 T -> G LOC_Os12g36580.1 downstream_gene_variant ; 1661.0bp to feature; MODIFIER silent_mutation Average:41.354; most accessible tissue: Callus, score: 87.829 N N N N
vg1222399044 T -> G LOC_Os12g36580-LOC_Os12g36590 intergenic_region ; MODIFIER silent_mutation Average:41.354; most accessible tissue: Callus, score: 87.829 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222399044 NA 8.94E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 1.14E-08 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 2.96E-07 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 1.38E-07 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 1.81E-09 mr1031 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 6.96E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 9.20E-07 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 3.00E-08 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 2.53E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 3.53E-06 mr1127 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 2.92E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 5.82E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 3.44E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 6.19E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 6.25E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 3.62E-08 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 1.10E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 1.71E-06 mr1513 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 4.27E-07 mr1590 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 3.83E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 8.47E-06 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 4.00E-06 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 1.54E-06 mr1981 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 7.15E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 9.10E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 7.07E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 6.06E-07 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 5.46E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 8.02E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 2.55E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222399044 NA 1.17E-07 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251