Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222398998:

Variant ID: vg1222398998 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22398998
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.04, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

CTGGGTTTTTACCATTATTTTCTTAACTGCAGATACAATGGGTCTGCTCCTGAAACACTTAACTGCAGATATGGGTTTAAGACAATTGCCAGATGGCAGA[G/T]
CCCCTCCGTGGAGGCTGTATCAGTCATCACCTGGTATAGATGAAGTTACATAACTCGTCACAATCGTTGCATAATTCTGATTTCTGAAGCTACATAATGC

Reverse complement sequence

GCATTATGTAGCTTCAGAAATCAGAATTATGCAACGATTGTGACGAGTTATGTAACTTCATCTATACCAGGTGATGACTGATACAGCCTCCACGGAGGGG[C/A]
TCTGCCATCTGGCAATTGTCTTAAACCCATATCTGCAGTTAAGTGTTTCAGGAGCAGACCCATTGTATCTGCAGTTAAGAAAATAATGGTAAAAACCCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	40.80%	0.47%	0.68%	NA
All Indica	2759	42.50%	56.90%	0.40%	0.25%	NA
All Japonica	1512	86.60%	13.20%	0.20%	0.00%	NA
Aus	269	37.90%	50.60%	2.60%	8.92%	NA
Indica I	595	39.80%	59.80%	0.34%	0.00%	NA
Indica II	465	39.60%	60.20%	0.22%	0.00%	NA
Indica III	913	45.00%	53.70%	0.77%	0.55%	NA
Indica Intermediate	786	43.30%	56.40%	0.13%	0.25%	NA
Temperate Japonica	767	91.40%	8.50%	0.13%	0.00%	NA
Tropical Japonica	504	78.00%	21.80%	0.20%	0.00%	NA
Japonica Intermediate	241	89.20%	10.40%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	4.20%	1.04%	1.04%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222398998	G -> DEL	N	N	silent_mutation	Average:42.213; most accessible tissue: Callus, score: 87.829	N	N	N	N
vg1222398998	G -> T	LOC_Os12g36590.1	upstream_gene_variant ; 4819.0bp to feature; MODIFIER	silent_mutation	Average:42.213; most accessible tissue: Callus, score: 87.829	N	N	N	N
vg1222398998	G -> T	LOC_Os12g36580.1	downstream_gene_variant ; 1615.0bp to feature; MODIFIER	silent_mutation	Average:42.213; most accessible tissue: Callus, score: 87.829	N	N	N	N
vg1222398998	G -> T	LOC_Os12g36580-LOC_Os12g36590	intergenic_region ; MODIFIER	silent_mutation	Average:42.213; most accessible tissue: Callus, score: 87.829	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222398998	NA	1.59E-08	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222398998	NA	2.04E-06	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222398998	NA	3.78E-09	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222398998	4.33E-06	NA	mr1851	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222398998	NA	6.82E-06	mr1209_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222398998	NA	2.05E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222398998	NA	7.34E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222398998	NA	3.27E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222398998	NA	6.93E-06	mr1388_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222398998	NA	4.64E-06	mr1706_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222398998	NA	6.58E-06	mr1924_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251