\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222372938:

Variant ID: vg1222372938 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22372938
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACACACGACGGCGCCGGCGAAACGCGCGAGTACAACCTCATCGACGGCGGCGTCGCTGCCAACAATCCTGTACAGTATTATTCCATCAGATTTGTAATTC[A/G]
TACTTCTTCCATTCCAAAATATGAGAAATTGGTAGTGCTAGAATGTGTCTCATTTAGTACTAGCTCCTTATATTCTTTTTTCAGACGATGGTAGCCATGA

Reverse complement sequence

TCATGGCTACCATCGTCTGAAAAAAGAATATAAGGAGCTAGTACTAAATGAGACACATTCTAGCACTACCAATTTCTCATATTTTGGAATGGAAGAAGTA[T/C]
GAATTACAAATCTGATGGAATAATACTGTACAGGATTGTTGGCAGCGACGCCGCCGTCGATGAGGTTGTACTCGCGCGTTTCGCCGGCGCCGTCGTGTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 8.90% 0.95% 0.00% NA
All Indica  2759 95.10% 4.40% 0.54% 0.00% NA
All Japonica  1512 90.10% 8.50% 1.46% 0.00% NA
Aus  269 70.30% 29.00% 0.74% 0.00% NA
Indica I  595 91.90% 6.10% 2.02% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 94.70% 5.30% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 4.70% 0.38% 0.00% NA
Temperate Japonica  767 93.20% 5.60% 1.17% 0.00% NA
Tropical Japonica  504 92.50% 7.10% 0.40% 0.00% NA
Japonica Intermediate  241 75.10% 20.30% 4.56% 0.00% NA
VI/Aromatic  96 15.60% 82.30% 2.08% 0.00% NA
Intermediate  90 81.10% 14.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222372938 A -> G LOC_Os12g36540.1 upstream_gene_variant ; 2180.0bp to feature; MODIFIER silent_mutation Average:61.64; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N
vg1222372938 A -> G LOC_Os12g36530.1 intron_variant ; MODIFIER silent_mutation Average:61.64; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222372938 NA 7.31E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222372938 NA 4.34E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222372938 NA 9.83E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222372938 NA 9.38E-07 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222372938 NA 1.07E-07 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222372938 NA 6.05E-07 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222372938 4.60E-06 1.25E-08 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222372938 2.64E-06 5.85E-08 mr1962_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251