\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222370405:

Variant ID: vg1222370405 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22370405
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.25, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTTTCAAATTCAACTCAGCATCCCATACGCACAATCTTCTCTTGTTTGCCACATGGAATCTTCATCACCATGTGCACTGTTCTTTAGCCTAAGCATCC[T/C]
GTATGTTCTCTTAATCATCCGGTCATTATATTCTCCTAGGTTGACTCCTAATTTATTTCCGACAACACTCTCTCGAGGTATCAAGACATACCTACACATT

Reverse complement sequence

AATGTGTAGGTATGTCTTGATACCTCGAGAGAGTGTTGTCGGAAATAAATTAGGAGTCAACCTAGGAGAATATAATGACCGGATGATTAAGAGAACATAC[A/G]
GGATGCTTAGGCTAAAGAACAGTGCACATGGTGATGAAGATTCCATGTGGCAAACAAGAGAAGATTGTGCGTATGGGATGCTGAGTTGAATTTGAAAGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.30% 25.70% 1.08% 0.00% NA
All Indica  2759 56.90% 41.40% 1.78% 0.00% NA
All Japonica  1512 96.10% 3.80% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 42.50% 57.50% 0.00% 0.00% NA
Indica II  465 26.00% 67.70% 6.24% 0.00% NA
Indica III  913 81.30% 18.40% 0.33% 0.00% NA
Indica Intermediate  786 57.60% 40.20% 2.16% 0.00% NA
Temperate Japonica  767 94.80% 5.00% 0.26% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222370405 T -> C LOC_Os12g36520.1 upstream_gene_variant ; 4696.0bp to feature; MODIFIER silent_mutation Average:37.32; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N
vg1222370405 T -> C LOC_Os12g36530.1 upstream_gene_variant ; 664.0bp to feature; MODIFIER silent_mutation Average:37.32; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N
vg1222370405 T -> C LOC_Os12g36540.1 upstream_gene_variant ; 4713.0bp to feature; MODIFIER silent_mutation Average:37.32; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N
vg1222370405 T -> C LOC_Os12g36520-LOC_Os12g36530 intergenic_region ; MODIFIER silent_mutation Average:37.32; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222370405 NA 3.06E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405 NA 1.11E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405 NA 4.52E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405 NA 9.78E-06 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405 NA 8.53E-06 mr1011_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405 NA 4.00E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405 NA 5.33E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405 NA 3.36E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405 NA 4.76E-17 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405 NA 5.08E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405 1.38E-06 1.38E-06 mr1983_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405 3.94E-06 3.94E-06 mr1983_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251