Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222370405:

Variant ID: vg1222370405 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22370405
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.25, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTTTCAAATTCAACTCAGCATCCCATACGCACAATCTTCTCTTGTTTGCCACATGGAATCTTCATCACCATGTGCACTGTTCTTTAGCCTAAGCATCC[T/C]
GTATGTTCTCTTAATCATCCGGTCATTATATTCTCCTAGGTTGACTCCTAATTTATTTCCGACAACACTCTCTCGAGGTATCAAGACATACCTACACATT

Reverse complement sequence

AATGTGTAGGTATGTCTTGATACCTCGAGAGAGTGTTGTCGGAAATAAATTAGGAGTCAACCTAGGAGAATATAATGACCGGATGATTAAGAGAACATAC[A/G]
GGATGCTTAGGCTAAAGAACAGTGCACATGGTGATGAAGATTCCATGTGGCAAACAAGAGAAGATTGTGCGTATGGGATGCTGAGTTGAATTTGAAAGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.30%	25.70%	1.08%	0.00%	NA
All Indica	2759	56.90%	41.40%	1.78%	0.00%	NA
All Japonica	1512	96.10%	3.80%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	42.50%	57.50%	0.00%	0.00%	NA
Indica II	465	26.00%	67.70%	6.24%	0.00%	NA
Indica III	913	81.30%	18.40%	0.33%	0.00%	NA
Indica Intermediate	786	57.60%	40.20%	2.16%	0.00%	NA
Temperate Japonica	767	94.80%	5.00%	0.26%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	93.80%	6.20%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222370405	T -> C	LOC_Os12g36520.1	upstream_gene_variant ; 4696.0bp to feature; MODIFIER	silent_mutation	Average:37.32; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N
vg1222370405	T -> C	LOC_Os12g36530.1	upstream_gene_variant ; 664.0bp to feature; MODIFIER	silent_mutation	Average:37.32; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N
vg1222370405	T -> C	LOC_Os12g36540.1	upstream_gene_variant ; 4713.0bp to feature; MODIFIER	silent_mutation	Average:37.32; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N
vg1222370405	T -> C	LOC_Os12g36520-LOC_Os12g36530	intergenic_region ; MODIFIER	silent_mutation	Average:37.32; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222370405	NA	3.06E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405	NA	1.11E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405	NA	4.52E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405	NA	9.78E-06	mr1066	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405	NA	8.53E-06	mr1011_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405	NA	4.00E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405	NA	5.33E-10	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405	NA	3.36E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405	NA	4.76E-17	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405	NA	5.08E-06	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405	1.38E-06	1.38E-06	mr1983_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222370405	3.94E-06	3.94E-06	mr1983_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251