\
| Variant ID: vg1222365340 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22365340 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 186. )
TTAGGATGACTTTATAATTTTATATGATGTTTAAAAAAGTAATTGATTCTTATGGAGGCACAATAGAACTTACATATACATGTTCCACTTCATATGCACT[A/G]
GAGGGATACCAGATGCTTAATAAGCACTGATAAAAAAACAGTAAGGCTTTATATTATGCTCCTAAAGGCTTTGAGATGGATCCACACTATTTATGTTTCT
AGAAACATAAATAGTGTGGATCCATCTCAAAGCCTTTAGGAGCATAATATAAAGCCTTACTGTTTTTTTATCAGTGCTTATTAAGCATCTGGTATCCCTC[T/C]
AGTGCATATGAAGTGGAACATGTATATGTAAGTTCTATTGTGCCTCCATAAGAATCAATTACTTTTTTAAACATCATATAAAATTATAAAGTCATCCTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 29.30% | 2.16% | 3.87% | NA |
| All Indica | 2759 | 47.90% | 42.50% | 3.66% | 5.98% | NA |
| All Japonica | 1512 | 86.80% | 12.90% | 0.00% | 0.33% | NA |
| Aus | 269 | 96.30% | 0.70% | 0.00% | 2.97% | NA |
| Indica I | 595 | 30.80% | 58.00% | 1.51% | 9.75% | NA |
| Indica II | 465 | 22.20% | 69.00% | 4.73% | 4.09% | NA |
| Indica III | 913 | 74.70% | 19.30% | 2.85% | 3.18% | NA |
| Indica Intermediate | 786 | 44.90% | 42.00% | 5.60% | 7.51% | NA |
| Temperate Japonica | 767 | 91.90% | 7.70% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 78.20% | 21.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 10.80% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 76.70% | 18.90% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222365340 | A -> DEL | N | N | silent_mutation | Average:50.106; most accessible tissue: Minghui63 flag leaf, score: 75.341 | N | N | N | N |
| vg1222365340 | A -> G | LOC_Os12g36520.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:50.106; most accessible tissue: Minghui63 flag leaf, score: 75.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222365340 | NA | 9.94E-06 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222365340 | NA | 9.57E-06 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222365340 | NA | 1.81E-09 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222365340 | NA | 6.86E-06 | mr1011_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222365340 | NA | 6.89E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222365340 | NA | 1.50E-06 | mr1186_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222365340 | NA | 5.84E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222365340 | NA | 6.90E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222365340 | NA | 1.62E-06 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222365340 | NA | 3.12E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222365340 | NA | 1.29E-17 | mr1352_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222365340 | NA | 1.82E-06 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222365340 | 9.60E-07 | 9.61E-07 | mr1983_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222365340 | 8.08E-06 | 8.08E-06 | mr1983_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |