\
| Variant ID: vg1222349292 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22349292 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 58. )
ACGGGCATCTTTTCTAGTACTCTATAAAATTATTGCAATACACTGAATAATAGTACGATAAAATTTCAATAGCCCCCGTGGTGTGGGTTGGTTGAAGGAA[G/A]
GAAAAGGATTACGGTTAAGGGGAACTAGGTTTTTAAGCTTTTATATGTCAATTTTAAATGGGCTTGTTGGGTCTATATTATTAAAATGGGCTAATTTTAT
ATAAAATTAGCCCATTTTAATAATATAGACCCAACAAGCCCATTTAAAATTGACATATAAAAGCTTAAAAACCTAGTTCCCCTTAACCGTAATCCTTTTC[C/T]
TTCCTTCAACCAACCCACACCACGGGGGCTATTGAAATTTTATCGTACTATTATTCAGTGTATTGCAATAATTTTATAGAGTACTAGAAAAGATGCCCGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.40% | 7.40% | 3.05% | 49.09% | NA |
| All Indica | 2759 | 19.30% | 11.80% | 0.72% | 68.18% | NA |
| All Japonica | 1512 | 75.10% | 0.30% | 7.21% | 17.46% | NA |
| Aus | 269 | 67.30% | 4.10% | 0.74% | 27.88% | NA |
| Indica I | 595 | 3.20% | 11.90% | 0.17% | 84.71% | NA |
| Indica II | 465 | 29.20% | 3.90% | 0.65% | 66.24% | NA |
| Indica III | 913 | 23.80% | 13.90% | 0.77% | 61.56% | NA |
| Indica Intermediate | 786 | 20.50% | 13.90% | 1.15% | 64.50% | NA |
| Temperate Japonica | 767 | 87.90% | 0.00% | 5.61% | 6.52% | NA |
| Tropical Japonica | 504 | 65.90% | 0.20% | 7.34% | 26.59% | NA |
| Japonica Intermediate | 241 | 53.50% | 1.20% | 12.03% | 33.20% | NA |
| VI/Aromatic | 96 | 11.50% | 2.10% | 10.42% | 76.04% | NA |
| Intermediate | 90 | 56.70% | 10.00% | 3.33% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222349292 | G -> DEL | N | N | silent_mutation | Average:32.628; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1222349292 | G -> A | LOC_Os12g36510.1 | downstream_gene_variant ; 779.0bp to feature; MODIFIER | silent_mutation | Average:32.628; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1222349292 | G -> A | LOC_Os12g36500-LOC_Os12g36510 | intergenic_region ; MODIFIER | silent_mutation | Average:32.628; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222349292 | NA | 7.35E-07 | mr1021 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222349292 | NA | 2.48E-06 | mr1176 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222349292 | NA | 3.76E-06 | mr1471 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222349292 | NA | 9.03E-07 | mr1631 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222349292 | NA | 3.79E-06 | mr1660 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222349292 | 3.21E-07 | 3.49E-07 | mr1738 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222349292 | 3.20E-06 | 3.20E-06 | mr1738 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |