\
| Variant ID: vg1222306332 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22306332 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AACTCCTCGTCAGCGGGATCCGCTTCATCTTCTTCAGCAACTGGGGGGGGGATTATTTATATAGAGCAAGGGTGAGTACGGGAGTACTCAGCAAGCCATG[G/T]
GAAATAAGTGTTTAATGCAGGCTTCAAGGAAAGGCTATTGTTTTTGCGATTGATTTTATTTAAACTCTTTTCAGAAACAACTAAGGGAGTGCTTCTCAAA
TTTGAGAAGCACTCCCTTAGTTGTTTCTGAAAAGAGTTTAAATAAAATCAATCGCAAAAACAATAGCCTTTCCTTGAAGCCTGCATTAAACACTTATTTC[C/A]
CATGGCTTGCTGAGTACTCCCGTACTCACCCTTGCTCTATATAAATAATCCCCCCCCCAGTTGCTGAAGAAGATGAAGCGGATCCCGCTGACGAGGAGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.00% | 2.70% | 1.52% | 6.75% | NA |
| All Indica | 2759 | 92.10% | 4.60% | 2.21% | 1.09% | NA |
| All Japonica | 1512 | 85.90% | 0.00% | 0.40% | 13.69% | NA |
| Aus | 269 | 69.50% | 0.00% | 1.49% | 29.00% | NA |
| Indica I | 595 | 82.90% | 10.60% | 6.39% | 0.17% | NA |
| Indica II | 465 | 95.70% | 1.70% | 1.51% | 1.08% | NA |
| Indica III | 913 | 97.90% | 0.50% | 0.55% | 0.99% | NA |
| Indica Intermediate | 786 | 90.10% | 6.60% | 1.40% | 1.91% | NA |
| Temperate Japonica | 767 | 89.40% | 0.00% | 0.26% | 10.30% | NA |
| Tropical Japonica | 504 | 80.80% | 0.00% | 0.60% | 18.65% | NA |
| Japonica Intermediate | 241 | 85.50% | 0.00% | 0.41% | 14.11% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 96.70% | 1.10% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222306332 | G -> DEL | N | N | silent_mutation | Average:27.189; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1222306332 | G -> T | LOC_Os12g36440.1 | upstream_gene_variant ; 4447.0bp to feature; MODIFIER | silent_mutation | Average:27.189; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1222306332 | G -> T | LOC_Os12g36450.1 | downstream_gene_variant ; 708.0bp to feature; MODIFIER | silent_mutation | Average:27.189; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1222306332 | G -> T | LOC_Os12g36450-LOC_Os12g36470 | intergenic_region ; MODIFIER | silent_mutation | Average:27.189; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222306332 | NA | 8.50E-08 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222306332 | NA | 2.40E-07 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222306332 | NA | 6.39E-06 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222306332 | NA | 9.96E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222306332 | 9.87E-07 | 4.30E-09 | mr1912 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222306332 | NA | 7.33E-06 | mr1043_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |