\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222302853:

Variant ID: vg1222302853 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22302853
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.33, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TAATCTAGAATGAAAACATGCTATAGAGCAGGTACAATAGCAGGCTATAAGCCAGCTGCAAACATATTTTAAGAAGATAAATTAGGAGAGAGAAGAGCAG[T/C]
GGGCTACAGATTTGTAGCCAGCTGTAGCACGGACTCCAAGACGCAGTGTGTCTATGACAGGTGGGACTAGATATTAATAGTGTAGTATGTAACTATTGTA

Reverse complement sequence

TACAATAGTTACATACTACACTATTAATATCTAGTCCCACCTGTCATAGACACACTGCGTCTTGGAGTCCGTGCTACAGCTGGCTACAAATCTGTAGCCC[A/G]
CTGCTCTTCTCTCTCCTAATTTATCTTCTTAAAATATGTTTGCAGCTGGCTTATAGCCTGCTATTGTACCTGCTCTATAGCATGTTTTCATTCTAGATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.60% 37.40% 0.42% 19.53% NA
All Indica  2759 65.60% 10.80% 0.51% 23.16% NA
All Japonica  1512 9.30% 84.40% 0.13% 6.15% NA
Aus  269 17.50% 15.20% 1.12% 66.17% NA
Indica I  595 75.60% 11.40% 0.17% 12.77% NA
Indica II  465 71.80% 12.50% 0.86% 14.84% NA
Indica III  913 59.10% 8.20% 0.44% 32.20% NA
Indica Intermediate  786 61.70% 12.20% 0.64% 25.45% NA
Temperate Japonica  767 3.50% 88.00% 0.00% 8.47% NA
Tropical Japonica  504 20.80% 78.80% 0.20% 0.20% NA
Japonica Intermediate  241 3.70% 84.60% 0.41% 11.20% NA
VI/Aromatic  96 2.10% 93.80% 0.00% 4.17% NA
Intermediate  90 17.80% 71.10% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222302853 T -> C LOC_Os12g36440.1 upstream_gene_variant ; 968.0bp to feature; MODIFIER silent_mutation Average:55.844; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg1222302853 T -> C LOC_Os12g36450.1 upstream_gene_variant ; 2245.0bp to feature; MODIFIER silent_mutation Average:55.844; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg1222302853 T -> C LOC_Os12g36440-LOC_Os12g36450 intergenic_region ; MODIFIER silent_mutation Average:55.844; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg1222302853 T -> DEL N N silent_mutation Average:55.844; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222302853 NA 9.04E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 1.33E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 9.76E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 3.15E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 1.82E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 1.33E-06 8.48E-08 mr1387 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 8.64E-06 mr1590 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 8.74E-06 mr1656 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 5.12E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 3.91E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 9.05E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 1.63E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 9.77E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 1.44E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 2.66E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 1.11E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 2.64E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 9.80E-07 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 5.16E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 6.60E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 3.95E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 3.50E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853 NA 3.91E-07 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251