Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222302853:

Variant ID: vg1222302853 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22302853
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.33, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TAATCTAGAATGAAAACATGCTATAGAGCAGGTACAATAGCAGGCTATAAGCCAGCTGCAAACATATTTTAAGAAGATAAATTAGGAGAGAGAAGAGCAG[T/C]
GGGCTACAGATTTGTAGCCAGCTGTAGCACGGACTCCAAGACGCAGTGTGTCTATGACAGGTGGGACTAGATATTAATAGTGTAGTATGTAACTATTGTA

Reverse complement sequence

TACAATAGTTACATACTACACTATTAATATCTAGTCCCACCTGTCATAGACACACTGCGTCTTGGAGTCCGTGCTACAGCTGGCTACAAATCTGTAGCCC[A/G]
CTGCTCTTCTCTCTCCTAATTTATCTTCTTAAAATATGTTTGCAGCTGGCTTATAGCCTGCTATTGTACCTGCTCTATAGCATGTTTTCATTCTAGATTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.60%	37.40%	0.42%	19.53%	NA
All Indica	2759	65.60%	10.80%	0.51%	23.16%	NA
All Japonica	1512	9.30%	84.40%	0.13%	6.15%	NA
Aus	269	17.50%	15.20%	1.12%	66.17%	NA
Indica I	595	75.60%	11.40%	0.17%	12.77%	NA
Indica II	465	71.80%	12.50%	0.86%	14.84%	NA
Indica III	913	59.10%	8.20%	0.44%	32.20%	NA
Indica Intermediate	786	61.70%	12.20%	0.64%	25.45%	NA
Temperate Japonica	767	3.50%	88.00%	0.00%	8.47%	NA
Tropical Japonica	504	20.80%	78.80%	0.20%	0.20%	NA
Japonica Intermediate	241	3.70%	84.60%	0.41%	11.20%	NA
VI/Aromatic	96	2.10%	93.80%	0.00%	4.17%	NA
Intermediate	90	17.80%	71.10%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222302853	T -> C	LOC_Os12g36440.1	upstream_gene_variant ; 968.0bp to feature; MODIFIER	silent_mutation	Average:55.844; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1222302853	T -> C	LOC_Os12g36450.1	upstream_gene_variant ; 2245.0bp to feature; MODIFIER	silent_mutation	Average:55.844; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1222302853	T -> C	LOC_Os12g36440-LOC_Os12g36450	intergenic_region ; MODIFIER	silent_mutation	Average:55.844; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1222302853	T -> DEL	N	N	silent_mutation	Average:55.844; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222302853	NA	9.04E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	1.33E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	9.76E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	3.15E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	1.82E-06	mr1344	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	1.33E-06	8.48E-08	mr1387	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	8.64E-06	mr1590	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	8.74E-06	mr1656	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	5.12E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	3.91E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	9.05E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	1.63E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	9.77E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	1.44E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	2.66E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	1.11E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	2.64E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	9.80E-07	mr1492_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	5.16E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	6.60E-08	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	3.95E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	3.50E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222302853	NA	3.91E-07	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251