Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1222295817:

Variant ID: vg1222295817 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22295817
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAAGCGACAATGTGAACGTGGCCTCAGAACGACGCCTTGGGTCTCCCTGTTGGAGTGTATAAAAGTGAATTGCCCGTCTTTCCTTATCAGCTTAGGTTT[T/C]
AGGTGCAACTGGTTAGTGCATGCAACTTAATATGGTATCAGAACCAGAGGTTTTGAGTTCGAATCCTGGCGGCCGTCGCGCCGCATGAAACTACCACATC

Reverse complement sequence

GATGTGGTAGTTTCATGCGGCGCGACGGCCGCCAGGATTCGAACTCAAAACCTCTGGTTCTGATACCATATTAAGTTGCATGCACTAACCAGTTGCACCT[A/G]
AAACCTAAGCTGATAAGGAAAGACGGGCAATTCACTTTTATACACTCCAACAGGGAGACCCAAGGCGTCGTTCTGAGGCCACGTTCACATTGTCGCTTCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	0.90%	1.42%	24.31%	NA
All Indica	2759	74.10%	0.00%	0.87%	25.01%	NA
All Japonica	1512	79.70%	2.60%	2.18%	15.48%	NA
Aus	269	19.30%	0.00%	3.35%	77.32%	NA
Indica I	595	87.20%	0.20%	0.00%	12.61%	NA
Indica II	465	78.10%	0.00%	1.29%	20.65%	NA
Indica III	913	66.90%	0.00%	1.10%	31.98%	NA
Indica Intermediate	786	70.10%	0.00%	1.02%	28.88%	NA
Temperate Japonica	767	80.80%	5.10%	2.87%	11.21%	NA
Tropical Japonica	504	76.00%	0.00%	1.79%	22.22%	NA
Japonica Intermediate	241	83.80%	0.40%	0.83%	14.94%	NA
VI/Aromatic	96	94.80%	1.00%	0.00%	4.17%	NA
Intermediate	90	83.30%	1.10%	1.11%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222295817	T -> C	LOC_Os12g36430.1	upstream_gene_variant ; 1015.0bp to feature; MODIFIER	silent_mutation	Average:77.792; most accessible tissue: Minghui63 panicle, score: 90.184	N	N	N	N
vg1222295817	T -> C	LOC_Os12g36430.2	upstream_gene_variant ; 1015.0bp to feature; MODIFIER	silent_mutation	Average:77.792; most accessible tissue: Minghui63 panicle, score: 90.184	N	N	N	N
vg1222295817	T -> C	LOC_Os12g36440.1	downstream_gene_variant ; 701.0bp to feature; MODIFIER	silent_mutation	Average:77.792; most accessible tissue: Minghui63 panicle, score: 90.184	N	N	N	N
vg1222295817	T -> C	LOC_Os12g36430-LOC_Os12g36440	intergenic_region ; MODIFIER	silent_mutation	Average:77.792; most accessible tissue: Minghui63 panicle, score: 90.184	N	N	N	N
vg1222295817	T -> DEL	N	N	silent_mutation	Average:77.792; most accessible tissue: Minghui63 panicle, score: 90.184	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1222295817	T	C	0.02	0.01	0.01	0.0	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222295817	NA	6.50E-10	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1222295817	NA	9.33E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817	9.83E-08	6.17E-07	mr1078	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817	NA	8.28E-06	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817	NA	9.06E-06	mr1201	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817	8.48E-07	2.06E-08	mr1613	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817	NA	3.14E-07	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817	7.00E-06	6.99E-06	mr1795	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817	4.71E-06	3.07E-07	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817	2.28E-07	1.15E-06	mr1982	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817	NA	9.92E-07	mr1274_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251