\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222295817:

Variant ID: vg1222295817 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22295817
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAAGCGACAATGTGAACGTGGCCTCAGAACGACGCCTTGGGTCTCCCTGTTGGAGTGTATAAAAGTGAATTGCCCGTCTTTCCTTATCAGCTTAGGTTT[T/C]
AGGTGCAACTGGTTAGTGCATGCAACTTAATATGGTATCAGAACCAGAGGTTTTGAGTTCGAATCCTGGCGGCCGTCGCGCCGCATGAAACTACCACATC

Reverse complement sequence

GATGTGGTAGTTTCATGCGGCGCGACGGCCGCCAGGATTCGAACTCAAAACCTCTGGTTCTGATACCATATTAAGTTGCATGCACTAACCAGTTGCACCT[A/G]
AAACCTAAGCTGATAAGGAAAGACGGGCAATTCACTTTTATACACTCCAACAGGGAGACCCAAGGCGTCGTTCTGAGGCCACGTTCACATTGTCGCTTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 0.90% 1.42% 24.31% NA
All Indica  2759 74.10% 0.00% 0.87% 25.01% NA
All Japonica  1512 79.70% 2.60% 2.18% 15.48% NA
Aus  269 19.30% 0.00% 3.35% 77.32% NA
Indica I  595 87.20% 0.20% 0.00% 12.61% NA
Indica II  465 78.10% 0.00% 1.29% 20.65% NA
Indica III  913 66.90% 0.00% 1.10% 31.98% NA
Indica Intermediate  786 70.10% 0.00% 1.02% 28.88% NA
Temperate Japonica  767 80.80% 5.10% 2.87% 11.21% NA
Tropical Japonica  504 76.00% 0.00% 1.79% 22.22% NA
Japonica Intermediate  241 83.80% 0.40% 0.83% 14.94% NA
VI/Aromatic  96 94.80% 1.00% 0.00% 4.17% NA
Intermediate  90 83.30% 1.10% 1.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222295817 T -> C LOC_Os12g36430.1 upstream_gene_variant ; 1015.0bp to feature; MODIFIER silent_mutation Average:77.792; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg1222295817 T -> C LOC_Os12g36430.2 upstream_gene_variant ; 1015.0bp to feature; MODIFIER silent_mutation Average:77.792; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg1222295817 T -> C LOC_Os12g36440.1 downstream_gene_variant ; 701.0bp to feature; MODIFIER silent_mutation Average:77.792; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg1222295817 T -> C LOC_Os12g36430-LOC_Os12g36440 intergenic_region ; MODIFIER silent_mutation Average:77.792; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg1222295817 T -> DEL N N silent_mutation Average:77.792; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1222295817 T C 0.02 0.01 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222295817 NA 6.50E-10 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1222295817 NA 9.33E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817 9.83E-08 6.17E-07 mr1078 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817 NA 8.28E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817 NA 9.06E-06 mr1201 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817 8.48E-07 2.06E-08 mr1613 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817 NA 3.14E-07 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817 7.00E-06 6.99E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817 4.71E-06 3.07E-07 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817 2.28E-07 1.15E-06 mr1982 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222295817 NA 9.92E-07 mr1274_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251