| Variant ID: vg1222263107 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22263107 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATTATATCTAATACATCTAGTTGAACCGATATATAAATCCGACTAGTCAAATTATAACCCGAGGTAATCAAGAAATAGGGTAATCATTGCAAATTGGCCA[T/C]
AACAAAGGAATAGGTTCACACCACCCGGTGACATTCGAAAATAAATGCACGATTTAATTAAATAGAGAATTTAAATATAGGATCAACATGCTCAAATGAA
TTCATTTGAGCATGTTGATCCTATATTTAAATTCTCTATTTAATTAAATCGTGCATTTATTTTCGAATGTCACCGGGTGGTGTGAACCTATTCCTTTGTT[A/G]
TGGCCAATTTGCAATGATTACCCTATTTCTTGATTACCTCGGGTTATAATTTGACTAGTCGGATTTATATATCGGTTCAACTAGATGTATTAGATATAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.40% | 0.80% | 1.06% | 21.69% | NA |
| All Indica | 2759 | 77.00% | 0.00% | 0.72% | 22.29% | NA |
| All Japonica | 1512 | 81.90% | 2.50% | 1.12% | 14.42% | NA |
| Aus | 269 | 29.00% | 0.00% | 4.46% | 66.54% | NA |
| Indica I | 595 | 88.90% | 0.00% | 0.50% | 10.59% | NA |
| Indica II | 465 | 81.10% | 0.00% | 0.86% | 18.06% | NA |
| Indica III | 913 | 70.20% | 0.00% | 0.99% | 28.81% | NA |
| Indica Intermediate | 786 | 73.40% | 0.00% | 0.51% | 26.08% | NA |
| Temperate Japonica | 767 | 83.10% | 4.80% | 1.56% | 10.56% | NA |
| Tropical Japonica | 504 | 79.80% | 0.00% | 0.20% | 20.04% | NA |
| Japonica Intermediate | 241 | 83.00% | 0.40% | 1.66% | 14.94% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 86.70% | 1.10% | 0.00% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222263107 | T -> C | LOC_Os12g36360.1 | intron_variant ; MODIFIER | silent_mutation | Average:28.953; most accessible tissue: Zhenshan97 flag leaf, score: 41.874 | N | N | N | N |
| vg1222263107 | T -> DEL | N | N | silent_mutation | Average:28.953; most accessible tissue: Zhenshan97 flag leaf, score: 41.874 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222263107 | NA | 4.57E-11 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1222263107 | NA | 1.90E-06 | mr1201 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222263107 | NA | 2.83E-06 | mr1219 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222263107 | 9.85E-07 | 2.64E-07 | mr1274 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222263107 | 9.95E-06 | 9.35E-07 | mr1274_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |