\
| Variant ID: vg1222234300 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22234300 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCGCTTGGGCTAGCCTAGGCTTGCTTTGGAGAATGGATTACATGGCCCATGTTGGTATTTCTTAACGACATTACTAGAAATATAATTCTTAGCAATGACG[C/T]
AGAAATACTTCTGGTATATTATGGTTACAGAGTCCATCCGCAAGCGCACGGATATACCATTGTAACATTTCATCCGAGAGTATTCCAAGGATATCGTATT
AATACGATATCCTTGGAATACTCTCGGATGAAATGTTACAATGGTATATCCGTGCGCTTGCGGATGGACTCTGTAACCATAATATACCAGAAGTATTTCT[G/A]
CGTCATTGCTAAGAATTATATTTCTAGTAATGTCGTTAAGAAATACCAACATGGGCCATGTAATCCATTCTCCAAAGCAAGCCTAGGCTAGCCCAAGCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.20% | 1.60% | 0.36% | 12.89% | NA |
| All Indica | 2759 | 86.60% | 0.00% | 0.43% | 12.94% | NA |
| All Japonica | 1512 | 80.80% | 4.80% | 0.20% | 14.22% | NA |
| Aus | 269 | 87.40% | 0.00% | 0.74% | 11.90% | NA |
| Indica I | 595 | 97.60% | 0.00% | 0.17% | 2.18% | NA |
| Indica II | 465 | 75.50% | 0.00% | 0.65% | 23.87% | NA |
| Indica III | 913 | 84.80% | 0.00% | 0.44% | 14.79% | NA |
| Indica Intermediate | 786 | 87.00% | 0.00% | 0.51% | 12.47% | NA |
| Temperate Japonica | 767 | 80.70% | 8.20% | 0.13% | 10.95% | NA |
| Tropical Japonica | 504 | 80.40% | 0.60% | 0.40% | 18.65% | NA |
| Japonica Intermediate | 241 | 81.70% | 2.90% | 0.00% | 15.35% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 1.10% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222234300 | C -> DEL | N | N | silent_mutation | Average:52.414; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg1222234300 | C -> T | LOC_Os12g36320.1 | upstream_gene_variant ; 3501.0bp to feature; MODIFIER | silent_mutation | Average:52.414; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg1222234300 | C -> T | LOC_Os12g36310.1 | downstream_gene_variant ; 1092.0bp to feature; MODIFIER | silent_mutation | Average:52.414; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg1222234300 | C -> T | LOC_Os12g36310-LOC_Os12g36320 | intergenic_region ; MODIFIER | silent_mutation | Average:52.414; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222234300 | NA | 5.55E-09 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1222234300 | 7.15E-07 | 7.15E-07 | mr1065 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222234300 | 1.91E-07 | 1.54E-06 | mr1078 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222234300 | 1.45E-06 | 1.45E-06 | mr1141 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222234300 | 1.28E-06 | 1.82E-06 | mr1517 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222234300 | 5.41E-06 | NA | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222234300 | 3.96E-06 | NA | mr1671 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |