\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222234300:

Variant ID: vg1222234300 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22234300
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGCTTGGGCTAGCCTAGGCTTGCTTTGGAGAATGGATTACATGGCCCATGTTGGTATTTCTTAACGACATTACTAGAAATATAATTCTTAGCAATGACG[C/T]
AGAAATACTTCTGGTATATTATGGTTACAGAGTCCATCCGCAAGCGCACGGATATACCATTGTAACATTTCATCCGAGAGTATTCCAAGGATATCGTATT

Reverse complement sequence

AATACGATATCCTTGGAATACTCTCGGATGAAATGTTACAATGGTATATCCGTGCGCTTGCGGATGGACTCTGTAACCATAATATACCAGAAGTATTTCT[G/A]
CGTCATTGCTAAGAATTATATTTCTAGTAATGTCGTTAAGAAATACCAACATGGGCCATGTAATCCATTCTCCAAAGCAAGCCTAGGCTAGCCCAAGCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.20% 1.60% 0.36% 12.89% NA
All Indica  2759 86.60% 0.00% 0.43% 12.94% NA
All Japonica  1512 80.80% 4.80% 0.20% 14.22% NA
Aus  269 87.40% 0.00% 0.74% 11.90% NA
Indica I  595 97.60% 0.00% 0.17% 2.18% NA
Indica II  465 75.50% 0.00% 0.65% 23.87% NA
Indica III  913 84.80% 0.00% 0.44% 14.79% NA
Indica Intermediate  786 87.00% 0.00% 0.51% 12.47% NA
Temperate Japonica  767 80.70% 8.20% 0.13% 10.95% NA
Tropical Japonica  504 80.40% 0.60% 0.40% 18.65% NA
Japonica Intermediate  241 81.70% 2.90% 0.00% 15.35% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 1.10% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222234300 C -> DEL N N silent_mutation Average:52.414; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1222234300 C -> T LOC_Os12g36320.1 upstream_gene_variant ; 3501.0bp to feature; MODIFIER silent_mutation Average:52.414; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1222234300 C -> T LOC_Os12g36310.1 downstream_gene_variant ; 1092.0bp to feature; MODIFIER silent_mutation Average:52.414; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1222234300 C -> T LOC_Os12g36310-LOC_Os12g36320 intergenic_region ; MODIFIER silent_mutation Average:52.414; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222234300 NA 5.55E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1222234300 7.15E-07 7.15E-07 mr1065 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222234300 1.91E-07 1.54E-06 mr1078 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222234300 1.45E-06 1.45E-06 mr1141 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222234300 1.28E-06 1.82E-06 mr1517 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222234300 5.41E-06 NA mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222234300 3.96E-06 NA mr1671 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251