Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222234300:

Variant ID: vg1222234300 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22234300
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGCTTGGGCTAGCCTAGGCTTGCTTTGGAGAATGGATTACATGGCCCATGTTGGTATTTCTTAACGACATTACTAGAAATATAATTCTTAGCAATGACG[C/T]
AGAAATACTTCTGGTATATTATGGTTACAGAGTCCATCCGCAAGCGCACGGATATACCATTGTAACATTTCATCCGAGAGTATTCCAAGGATATCGTATT

Reverse complement sequence

AATACGATATCCTTGGAATACTCTCGGATGAAATGTTACAATGGTATATCCGTGCGCTTGCGGATGGACTCTGTAACCATAATATACCAGAAGTATTTCT[G/A]
CGTCATTGCTAAGAATTATATTTCTAGTAATGTCGTTAAGAAATACCAACATGGGCCATGTAATCCATTCTCCAAAGCAAGCCTAGGCTAGCCCAAGCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.20%	1.60%	0.36%	12.89%	NA
All Indica	2759	86.60%	0.00%	0.43%	12.94%	NA
All Japonica	1512	80.80%	4.80%	0.20%	14.22%	NA
Aus	269	87.40%	0.00%	0.74%	11.90%	NA
Indica I	595	97.60%	0.00%	0.17%	2.18%	NA
Indica II	465	75.50%	0.00%	0.65%	23.87%	NA
Indica III	913	84.80%	0.00%	0.44%	14.79%	NA
Indica Intermediate	786	87.00%	0.00%	0.51%	12.47%	NA
Temperate Japonica	767	80.70%	8.20%	0.13%	10.95%	NA
Tropical Japonica	504	80.40%	0.60%	0.40%	18.65%	NA
Japonica Intermediate	241	81.70%	2.90%	0.00%	15.35%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	1.10%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222234300	C -> DEL	N	N	silent_mutation	Average:52.414; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg1222234300	C -> T	LOC_Os12g36320.1	upstream_gene_variant ; 3501.0bp to feature; MODIFIER	silent_mutation	Average:52.414; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg1222234300	C -> T	LOC_Os12g36310.1	downstream_gene_variant ; 1092.0bp to feature; MODIFIER	silent_mutation	Average:52.414; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg1222234300	C -> T	LOC_Os12g36310-LOC_Os12g36320	intergenic_region ; MODIFIER	silent_mutation	Average:52.414; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222234300	NA	5.55E-09	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1222234300	7.15E-07	7.15E-07	mr1065	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222234300	1.91E-07	1.54E-06	mr1078	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222234300	1.45E-06	1.45E-06	mr1141	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222234300	1.28E-06	1.82E-06	mr1517	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222234300	5.41E-06	NA	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222234300	3.96E-06	NA	mr1671	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251